SNPs Associated with PCOS

 

Search by alphabet
1 to 10 of 117 SNPs
Gene SNP Id Upstream Sequence
SNP
Downstream Sequence Functional Significance
References
ACVR1 rs1220134 CTTGAGGATCATATTACTCCAAGAGA
A/T
CTATCTGGTCATCAATTTTTATAAT Intron variant
ACVR1 rs10497189 CCACAATATGCATCAAAATGTGTTCT
C/T
GGACATTAGTTATTCTTAATAAAGA Intron variant
ACVR1 rs2033962 GTGCCATAGACCTTTGGAGGGAGCTC
G/T
GAAAGCTGAATTTCCTAATATGAAC Intron variant
AKT2 rs3730051 GGTGGAGGGAAATTTCAGTGTCATCT
A/G
GTGCCCCTCTCCCTTGAGGCAGGCG Intron variant
AKT2 rs8100018 aaaaaaaaaaaaaaaaaaaGCAGGGG
C/G
CGGGGACAGGGCAGGAGCCCATTCC Intron variant
AMH rs10407022 AGAAGACTTGGACTGGCCTCCAGGCA
G/T
CCCACAAGAGCCTCTGTGCCTGGTG I49S
AMH rs8112524 AGAAGACTTGGACTGGCCTCCAGGCA
G/T
CCCACAAGAGCCTCTGTGCCTGGTG Intron variant,upstream variant 2KB
AMHR2 rs2002555 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT -482 A>G
AR rs6152 TAGAAGTTCTGATAGCAGAAAAAAGA
C/T
GCAGGATTTCCACAGAAGAGAAACT Synonymous codon

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412