YAP1

Gene Information
 
Gene Symbol
YAP1
 
Aliases
COB1, YAP, YAP2, YAP65, YKI
 
Entrez Gene ID
 
Gene Name
Yes-associated protein 1
 
Chromosomal Location
11q13
 
HGNC ID
 
Summary
This gene encodes a downstream nuclear effector of the Hippo signaling pathway which is involved in development, growth, repair, and homeostasis. This gene is known to play a role in the development and progression of multiple cancers as a transcriptional regulator of this signaling pathway and may function as a potential target for cancer treatment. Alternative splicing results in multiple transcript variants encoding different isoforms. (provided by RefSeq, Aug 2013)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs1894116 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT Intron variant 22885925

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006974 Biological process Cellular response to DNA damage stimulus IDA 18280240
GO:0008283 Biological process Cell proliferation IDA 17974916
GO:0035329 Biological process Hippo signaling TAS 18158288
GO:0060242 Biological process Contact inhibition IDA 17974916
GO:0071480 Biological process Cellular response to gamma radiation IDA 18280240
Protein Information
 
Protein Name
65 kDa Yes-associated protein, protein yorkie homolog, yes-associated protein 2, yes-associated protein YAP65 homolog, yorkie homolog
 
Function
Transcriptional regulator which can act both as a coactivator and a corepressor and is the critical downstream regulatory target in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Plays a key role to control cell proliferation in response to cell contact. Phosphorylation of YAP1 by LATS1/2 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration. The presence of TEAD transcription factors are required for it to stimulate gene expression, cell growth, anchorage-independent growth, and epithelial mesenchymal transition (EMT) induction. Isoform 2 and isoform 3 can activate the C-terminal fragment (CTF) of ERBB4 (isoform 3)
 
Refseq Proteins
 
UniProt
 
InterPro
Accessions
IPR001202
 
KEGG
 
OMIM
 
Phenotype MIM ID

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 24106282
   
References
 
Primary:

Cross-ethnic meta-analysis of genetic variants for polycystic ovary syndrome.

Louwers Yvonne V, Stolk Lisette, Uitterlinden Andre G, Laven Joop S E
MD, Department of Gynecology and Obstetrics, Room Na-1524, Erasmus MC, P.O. Box 2040, 3000 CA Rotterdam, The Netherlands. y.louwers@erasmusmc.nl.
J Clin Endocrinol Metab. 2013 Dec;98(12):E2006-12. doi: 10.1210/jc.2013-2495.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
LHCGR, THADA, DENND1A, FSHR, c9orf3, RAB5B/SUOX, HMGA2, TOX3, INSR, SUMO1P1 
 
rs1894116 
Rotterdam criteria 
Direct 
703 Dutch PCOS patients and 2164 Dutch controls 
This study identifies 12 genetic variants mapping to the Chinese PCOS loci similar effect size and identical direction in PCOS patients from Northern European ancestry, indicating a common genetic risk profile for PCOS across populations 
 
PCOS 
 
Rotterdam criteria 
Direct 
1115 PCOS patients, 1137 controls 
YAP1 appears to be a new susceptibility gene for PCOS in Han Chinese women 

Unreviewed Literature:

Show/Hide all(2)
PubMed / PMC ID
Title Type of study
26416764
Causal mechanisms and balancing selection inferred from genetic associations with polycystic ovary syndrome. 
Clinical study 
25904635, PMC4498224
Han Chinese polycystic ovary syndrome risk variants in women of European ancestry: relationship to FSH levels and glucose tolerance. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412