VDR

Gene Information
 
Gene Symbol
VDR
 
Aliases
NR1I1, PPP1R163
 
Entrez Gene ID
 
Gene Name
Vitamin D (1,25- dihydroxyvitamin D3) receptor
 
Chromosomal Location
12q12-q14
 
HGNC ID
 
Summary
This gene encodes the nuclear hormone receptor for vitamin D3. This receptor also functions as a receptor for the secondary bile acid lithocholic acid. The receptor belongs to the family of trans-acting transcriptional regulatory factors and shows sequence similarity to the steroid and thyroid hormone receptors. Downstream targets of this nuclear hormone receptor are principally involved in mineral metabolism though the receptor regulates a variety of other metabolic pathways, such as those involved in the immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternative splicing results in multiple transcript variants encoding different proteins. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs731236 CCTGGGGTGCAGGACGCCGCGCTGAT
C/T
GAGGCCATCCAGGACCGCCTGTCCA Synonymous codon,upstream variant 2KB 24078159, 21082232
rs10735810 CCTGGGGTGCAGGACGCCGCGCTGAT
C/T
GAGGCCATCCAGGACCGCCTGTCCA M1T 21082232
rs1544410 CCTGGGGTGCAGGACGCCGCGCTGAT
C/T
GAGGCCATCCAGGACCGCCTGTCCA Intron variant,upstream variant 2KB 21082232
rs7975232 GAAGGCACAGGAGCTCTCAGCTGGGC
A/C
CCTCACTGCTCAATCCCACCACCCC Intron variant,upstream variant 2KB 21082232
rs757343 TTTGGAGGCAATGTGCAGTGACCCTT
A/G
ACCTCTTCCGCTGGTTAGAGGTGAG Intron variant,upstream variant 2KB 21082232, 23246977

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0000122 Biological process Negative regulation of transcription from RNA polymerase II promoter IDA 17426122
GO:0006351 Biological process Transcription, DNA-dependent IDA 17426122
GO:0007165 Biological process Signal transduction TAS 2849209
GO:0008285 Biological process Negative regulation of cell proliferation IDA 16549446
GO:0010980 Biological process Positive regulation of vitamin D 24-hydroxylase activity IDA 16549446
Protein Information
 
Protein Name
Vitamin D3 receptor
 
Function
Nuclear hormone receptor. Transcription factor that mediates the action of vitamin D3 by controlling the expression of hormone sensitive genes. Regulates transcription of hormone sensitive genes via its association with the WINAC complex, a chromatin-remodeling complex. Recruited to promoters via its interaction with the WINAC complex subunit BAZ1B/WSTF, which mediates the interaction with acetylated histones, an essential step for VDR-promoter association. Plays a central role in calcium homeostasis
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00104 Hormone_recep Ligand-binding domain of nuclear hormone receptor
PF00105 zf-C4 Zinc finger, C4 type (two domains)
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions

Associated Diseases

Diseases References
Arthritis 12375338, 10902746, 11824954, 9218501, 9811048, 9259424, 15801025, 12360016, 9506753, 19073371, 12431791, 10662878, 18288556
Asthma 15282199, 15663557, 15282200, 20124605, 19622139, 15651992, 17213369, 19906117, 19852851, 19247692
Autoimmune diseases 19031030, 12188026, 11786968, 19758226, 15683428, 18594491, 11562285, 12009019, 19818218, 15104566, 18054230, 18069754, 15294940, 12843155, 11134121, 19287183, 18752562, 16528410, 17943423, 18290726, 19441936, 18393827, 16753019, 11801650, 19758159, 18506225, 19376604, 17967727, 12846052, 18361940, 18277116, 16100768, 16278149
Bone loss 15225828, 9470473, 8806247, 9600794, 10367040, 11684540, 11230734, 9598881, 10525708, 19151030, 7572323, 16076355, 17363400, 10457270, 8530616, 18322050, 9625456, 18316854, 12759877, 9286761, 8970885, 16355284, 11251690, 9568826, 9506753, 17223552, 10505806, 7853953, 11150427, 15455736, 12666703, 9914315, 12792298, 11489147, 8765980
Calcification 18287084, 16641675, 17408120, 20411052, 17072776, 17347966, 8536923, 17293681, 18448587
   
References
 
Primary:

Vitamin D-associated polymorphisms are related to insulin resistance and vitamin D deficiency in polycystic ovary syndrome.

Wehr Elisabeth, Trummer Olivia, Giuliani Albrecht, Gruber Hans-Jurgen, Pieber Thomas R, Obermayer-Pietsch Barbara
Department of Internal Medicine, Medical University of Graz, Auenbruggerplatz 15, 8036 Graz, Austria. elisabeth.wehr@medunigraz.at
Eur J Endocrinol. 2011 May;164(5):741-9. Epub 2011 Mar 9.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
CASR 
 
rs10735810, rs7975232, rs757343, rs731236 
NICHD criteria 
Related 
56 Iranian PCOS women 
This data indicated for the first time that it is possible that the VDR and CASR gene variants through their effects on LH and SHBG levels, and insulin resistance are involved in pathogenesis of PCOS 
 
 
rs731236 
 
Direct 
150 Egyptian women with PCOS, 150 unrelated controls 
The results suggested that, VDRTaq-I gene polymorphism is associated with increased risk of PCOS in Egyptian women 
 
 
rs757343 
 
Related 
260 PCOS women (cases), 221 normoovulatory women (controls) 
The genetic variant of the VDR was found to have an association with severity of clinical features of PCOS, but none with disease risk 
GC, DHCR7, CYP2R1 
 
 
 
Related 
545 PCOS, 145 control women 
VDR and vitamin D level-related variants are associated with metabolic and endocrine parameters including 25(OH)D levels in PCOSwomen 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26422783
Classic PCOS phenotype is not associated with deficiency of endogenous vitamin D and VDR gene polymorphisms rs731236 (TaqI), rs7975232 (ApaI), rs1544410 (BsmI), rs10735810 (FokI): a case-control study of lower Silesian women. 
Clinical study 
24520473, PMC3850346
Vitamin D Receptor TaqI Gene Variant in Exon 9 and Polycystic Ovary Syndrome Risk. 
Clinical study 
23889482
Effect of 1??,25-dihydroxyvitamin D3 on progesterone secretion by porcine ovarian granulosa cells. 
In vitro 
23483766, PMC3593280
Lack of Association of Vitamin D Receptor FokI (rs10735810) (C/T) and BsmI (rs1544410) (A/G) Genetic Variations with Polycystic Ovary Syndrome Risk: a Case-control Study from Iranian Azeri Turkish Women. 
Clinical study 
23276559
Vitamin D receptor 1a promotor -1521 G/C and -1012 A/G polymorphisms in polycystic ovary syndrome. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412