THADA

Gene Information
 
Gene Symbol
THADA
 
Aliases
GITA
 
Entrez Gene ID
 
Gene Name
Thyroid adenoma associated
 
Chromosomal Location
2p21
 
HGNC ID
 
Summary
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs13429458 TGCTGTGCAAAGTTAGAAGATGAAAC
A/C
AAACTGATTACATACACCTATACCC Intron variant 25586784, 21151128
rs12478601 ATTCCTGCTGGTCTTGGTTAGTACCA
C/T
TCAATAAAATGTTAGGACCCGGGCT Intron variant 25586784
Protein Information
 
Protein Name
Gene inducing thyroid adenomas protein , FLJ21877 , GITA , FLJ44016 , FLJ77530 , gene inducing thyroid adenomas protein , thyroid adenoma-associated protein , thyroid adenoma associated, KIAA1767 , OTTHUMP00000201591 , death receptor-interacting protein , FLJ44876 , OTTHUMP00000201592
 
Function
 
Refseq Proteins
 
UniProt
 
InterPro
Accessions
IPR019442, IPR016024
 
Pfam
Pfam Accession Pfam ID
PF10350 DUF2428 Putative death-receptor fusion protein (DUF2428)
 
OMIM
 
Interactions
STRING MINT I2D
Q6YHU6

Associated Diseases

Diseases References
Hyperandrogenism 22180642
Polycystic ovary syndrome (PCOS) 23208300, 22081247, 25303487, 24106282, 23208300
   
References
 
Primary:

Family-based analysis of susceptibility loci for polycystic ovary syndrome on chromosome 2p16.3, 2p21 and 9q33.3.

Zhao Han, Xu Xinghua, Xing Xiuye, Wang Jianfeng, He Lin, Shi Yongyong, Shi Yuhua, Zhao Yueran, Chen Zi-Jiang
Center for Reproductive Medicine, Provincial Hospital Affiliated to Shandong University, 324 Jingwu Road, 250021 Jinan, People's Republic of China.
Hum Reprod. 2012 Jan;27(1):294-8. Epub 2011 Nov 10.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
SNP rs13429458 
Rotterdam criteria 
Related 
A total of 276 family trios (828 participants) having a proband with PCOS  
TDT confirms that SNP rs13429458, in the THADA gene, is significantly associated with risk of PCOS 
DENND1A 
Hyperandrogenism and irregular menses 
Variation in the DENND1A 
NICHD criteria 
Direct 
European derived PCOS cohorts-(cohort A = 939 cases and 957 controls) and (cohort B = 535 cases and 845 controls) 
At least two of the PCOS susceptibility loci identified in the Chinese PCOS GWAS (DENND1A and THADA) are also associated with PCOS in European derived populations, and are therefore likely to be important in the aetiology of PCOS regardless of ethnicity. The analysis of the LHCGR gene was not sufficiently powered to detect modest effects. 
DENND1A and LHCGR 
 
SNP variants rs13429458, rs12478601, rs2479106, rs10818854 and rs13405728 
Rotterdam criteria 
Direct 
1731 PCOS patients and 4964 controls 
carry risk alleles that are associated with endocrine and metabolic disturbances in PCOS patients 
LHCGR, DENND1A, FSHR, c9orf3, YAP1, RAB5B/SUOX, HMGA2, TOX3, INSR, SUMO1P1 
 
rs12468394, rs13429458, rs12478601  
Rotterdam criteria 
Direct 
703 Dutch PCOS patients and 2164 Dutch controls 
This study identifies 12 genetic variants mapping to the Chinese PCOS loci similar effect size and identical direction in PCOS patients from Northern European ancestry, indicating a common genetic risk profile for PCOS across populations 
 
 
 
 
Direct 
46 European subjects with PCOS and 845 controls 
Four of the PCOS susceptibility loci identified in the Chinese GWAS are associated with PCOS in Europeans 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26416764
Causal mechanisms and balancing selection inferred from genetic associations with polycystic ovary syndrome. 
Clinical study 
25978310, PMC4433204
Association Study between Polycystic Ovarian Syndrome and the Susceptibility Genes Polymorphisms in Hui Chinese Women. 
Clinical study 
25904635, PMC4498224
Han Chinese polycystic ovary syndrome risk variants in women of European ancestry: relationship to FSH levels and glucose tolerance. 
Clinical study 
25586784
Polycystic ovary syndrome susceptibility single nucleotide polymorphisms in women with a single PCOS clinical feature. 
Clinical study 
25169637
[Correlation analysis between polycystic ovary syndrome susceptibility genes and metabolic phenotypes]. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412