TGFB1

Gene Information
 
Gene Symbol
TGFB1
 
Aliases
CED, DPD1, LAP, TGFB, TGFbeta
 
Entrez Gene ID
 
Gene Name
Transforming growth factor, beta 1
 
Chromosomal Location
19q13.1
 
HGNC ID
 
Summary
This gene encodes a member of the transforming growth factor beta (TGFB) family of cytokines, which are multifunctional peptides that regulate proliferation, differentiation, adhesion, migration, and other functions in many cell types. Many cells have TGFB receptors, and the protein positively and negatively regulates many other growth factors. The secreted protein is cleaved into a latency-associated peptide (LAP) and a mature TGFB1 peptide, and is found in either a latent form composed of a TGFB1 homodimer, a LAP homodimer, and a latent TGFB1-binding protein, or in an active form composed of a TGFB1 homodimer. The mature peptide may also form heterodimers with other TGFB family members. This gene is frequently upregulated in tumor cells, and mutations in this gene result in Camurati-Engelmann disease.(provided by RefSeq, Oct 2009)
 
GeneCards ID
 
UniGene
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs4803457 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT Intron variant,upstream variant 2KB 25594618

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0001933 Biological process Negative regulation of protein phosphorylation IDA 8053900
GO:0001934 Biological process Positive regulation of protein phosphorylation IDA 18625725
GO:0002062 Biological process Chondrocyte differentiation IDA 15040835
GO:0002244 Biological process Hematopoietic progenitor cell differentiation IDA 15451575
GO:0002248 Biological process Connective tissue replacement involved in inflammatory response wound healing TAS 9639571
Protein Information
 
Protein Name
Latency-associated peptide
 
Function
Multifunctional protein that controls proliferation, differentiation and other functions in many cell types. Many cells synthesize TGFB1 and have specific receptors for it. It positively and negatively regulates many other growth factors. It plays an important role in bone remodeling as it is a potent stimulator of osteoblastic bone formation, causing chemotaxis, proliferation and differentiation in committed osteoblasts
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00019 TGF_beta Transforming growth factor beta like domain
PF00688 TGFb_propeptide TGF-beta propeptide
 
OMIM
 
Phenotype MIM ID

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 21411746, 20630504
   
References
 
Primary:

Linkage of regulators of TGF-beta activity in the fetal ovary to polycystic ovary syndrome.

Hatzirodos Nicholas, Bayne Rosemary A, Irving-Rodgers Helen F, Hummitzsch Katja, Sabatier Laetitia, Lee Sam, Bonner Wendy, Gibson Mark A, Rainey William E, Carr Bruce R, Mason Helen D, Reinhardt Dieter P, Anderson Richard A, Rodgers Raymond J
Research Centre for Reproductive Health, Discipline of Obstetrics and Gynaecology, Robinson Institute, University of Adelaide, SA, 5005, Australia.
FASEB J. 2011 Jul;25(7):2256-65. doi: 10.1096/fj.11-181099. Epub 2011 Mar 16.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
TGFB2, TGFB3, LTBP1,LTBP2,LTBP3, LTBP4 and FBN genes 
 
 
 
Related 
 
The results indicate that TGF pathways operate during ovarian fetal development, but most important, we show fibrillin 3 is present in the stromal compartments of fetal ovaries and is highly expressed at a critical stage early in developing human and bovine fetal ovaries when stroma is expanding and follicles are forming in PCOS 
 
 
(A8) of D19S884 in the fibrillin-3 gene 
NIH criteria 
Related 
 
Allele8- PCOS is associated with higher levels of TGF-1 compared with A8+ PCOS or A8- Non-PCOS, similar levels of TGF-2 compared with A8+ PCOS but lower levels of TGF-2 compared with A8- Non-PCOS, and lower levels of inhibin B and aldosterone compared with A8+ PCOS. 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412