TCF7L2

Gene Information
 
Gene Symbol
TCF7L2
 
Aliases
TCF-4, TCF4
 
Entrez Gene ID
 
Gene Name
Transcription factor 7-like 2 (T-cell specific, HMG-box)
 
Chromosomal Location
10q25.3
 
HGNC ID
 
Summary
 
GeneCards ID
 
RefSeq DNA
 
RefSeq mRNA
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs11196236 aaaaaaaaaaaaaaaaaaaGCAGGGG
C/G
CGGGGACAGGGCAGGAGCCCATTCC Intron variant 19351735, 22301903, 23935130
rs11196229 CGATTACTACGCCTACAGCCCTGTGC
A/G
GGAGCGGGACGCCCACTCCGTCCTC Intron variant 19351735
rs7903146 TGAGCTTTGATGAGCCTCAGAAGAAC
G/T
CCATGGCCCACAGGAATTCTACGCA Intron variant 24611738, 23935130, 18958766
rs12255372 CTGCTCTTCAGCTCCCAGAGTCACCA
A/G
TGGTTCCACTTACATACTTGTCCCT Intron variant 24611738
rs290487 aaaaaaaaaaaaaaaaaaaGCAGGGG
C/G
CGGGGACAGGGCAGGAGCCCATTCC Intron variant 22296403

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0000122 Biological process Negative regulation of transcription from RNA polymerase II promoter IDA 12799378
GO:0001568 Biological process Blood vessel development IMP 15578569
GO:0006351 Biological process Transcription, DNA-dependent IDA 9727977
GO:0006357 Biological process Regulation of transcription from RNA polymerase II promoter IDA 9727977
GO:0006916 Biological process Anti-apoptosis IDA 18071026
Protein Information
 
Protein Name
HMG box transcription factor 4, T-cell factor 4, T-cell factor-4 variant A, T-cell factor-4 variant B, T-cell factor-4 variant C, T-cell factor-4 variant D, T-cell factor-4 variant E, T-cell factor-4 variant F, T-cell factor-4 variant G, T-cell factor-4 variant H, T-cell factor-4 variant I, T-cell factor-4 variant J, T-cell factor-4 variant K, T-cell factor-4 variant L, T-cell factor-4 variant M, T-cell factor-4 variant X2, T-cell-specific transcription factor 4, hTCF-4
 
Function
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00505 HMG_box HMG (high mobility group) box
PF08347 CTNNB1_binding N-terminal CTNNB1 binding
 
OMIM
 
Phenotype MIM ID

Associated Diseases

Diseases References
Cardiovascular diseases 22904171
Chronic anovulation 20092643
Diabetes mellitus 22904171, 22296403, 20092643
Diabetes mellitus type 2 19351735
Hyperandrogenism 20092643
   
References
 
Primary:

Differential gene expression in granulosa cells from polycystic ovary syndrome patients with and without insulin resistance: identification of susceptibility gene sets through network analysis.

Kaur Surleen, Archer Kellie J, Devi M Gouri, Kriplani Alka, Strauss Jerome F 3rd, Singh Rita
Department of Zoology, University of Delhi, Delhi 110007, India.
J Clin Endocrinol Metab. 2012 Oct;97(10):E2016-21. doi: 10.1210/jc.2011-3441.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
NCF2,SERPINA1,ITGAX,TAB2,IGF2R,TXNIP 
Diabetes mellitus, inflammation, cardiovascular diseases, and infertility in the granulosa cells,follicular growth arrest and metabolic disorders 
 
 
Related 
 
Real-time quantitative PCR confirmed higher expression of NCF2 (2.13-fold), TCF7L2 (1.92-fold), and SERPINA1 (5.35-fold). Increased expression of inflammation genes ITGAX (3.68-fold) and TAB2 (1.86-fold) was confirmed in PCOS non-IR 
 
Type 2 diabetes,impairment of glucose homeostasis 
SNPs rs11196218 and rs290487 of the TCF7L2 gene 
 
Related 
Chinese population- 430 PCOS patients and 360 controls 
The data suggests that the TCF7L2 variants may confer an increased risk for early impairment of glucose homeostasis in PCOS 
 
Type 2 diabetes mellitus 
58 single nucleotide polymorphisms mapping to TCF7L2(associated SNP's-rs11196236,rs11196229) 
NICHD, Rotterdam, Androgen Excess Society criteria 
Related 
European ancestry-624 PCOS and 553 control women  
We have observed evidence of association with two independent TCF7L2 loci in a PCOS cohort: 
KCNJ11 E23K variants 
Hyperinsulinemia and type 2 diabetes mellitus 
TCF7L2 rs7903146(C/T) 
 
Related 
Greek population-183 PCOS patients and 148 healthy controls 
These data provide evidence that the rs7903146 variant of the TCF7L2 gene might influence PCOS predisposition, while no association is observed between the E23K variant of KCNJ11 and susceptibility to PCOS and related traits. 
 
PCOS 
rs4506565, rs7903146, rs12243326, and rs12255372  
 
Weak or Unrelated 
119 Tunisian women with PCOS (mean age 29.8 4.7years), and 150 control women (mean age 30.6 5.9years) 
The data suggest that there is weak or no contribution of TCF7L2 gene polymorphism to PCOS in Tunisian women. Further studies with larger samples are necessary to confirm this observation. 

Unreviewed Literature:

Show/Hide all(5)
PubMed / PMC ID
Title Type of study
25678248
Association between rs7903146 and rs12255372 polymorphisms of transcription factor 7-like 2 gene and polycystic ovary syndrome: a systematic review and meta-analysis. 
Clinical study 
24815492
Genetic polymorphisms of TCF7L2 lack influence on risk of the polycystic ovary syndrome - a systemic analysis. 
Clinical study 
24611738
Relationships between TCF7L2 genetic polymorphisms and polycystic ovary syndrome risk: a meta-analysis. 
Meta analysis 
22480428
T2D risk haplotypes of the TCF7L2 gene in the Czech population sample: the association with free fatty acids composition. 
Clinical study 
22443257
Polycystic ovary syndrome is not associated with polymorphisms of the TCF7L2, CDKAL1, HHEX, KCNJ11, FTO and SLC30A8 genes. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412