SULT2A1

Gene Information
 
Gene Symbol
SULT2A1
 
Aliases
DHEA-ST, DHEAS, HST, ST2, ST2A1, ST2A3, STD, hSTa
 
Entrez Gene ID
 
Gene Name
Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
 
Chromosomal Location
19q13.3
 
HGNC ID
 
Summary
This gene encodes a member of the sulfotransferase family. Sulfotransferases aid in the metabolism of drugs and endogenous compounds by converting these substances into more hydrophilic water-soluble sulfate conjugates that can be easily excreted. This protein catalyzes the sulfation of steroids and bile acids in the liver and adrenal glands, and may have a role in the inherited adrenal androgen excess in women with polycystic ovary syndrome. (provided by RefSeq, Mar 2010)
 
GeneCards ID
 
UniGene
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs182420 TAGAAGTTCTGATAGCAGAAAAAAGA
C/T
GCAGGATTTCCACAGAAGAGAAACT Intron variant 17426092

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0007586 Biological process Digestion NAS 1588921
GO:0008202 Biological process Steroid metabolic process TAS 1588921
Protein Information
 
Protein Name
Bile salt sulfotransferase
 
Function
Sulfotransferase that utilizes 3`-phospho-5`-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfonation of steroids and bile acids in the liver and adrenal glands
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
Accessions
IPR000863
 
Pfam
Pfam Accession Pfam ID
PF00685 Sulfotransfer_1 Sulfotransferase domain
 
KEGG
 
OMIM

Associated Diseases

Diseases References
Adrenal androgen excess. 15705377, 11119758, 15514033
Anovulation 17426408, 16691383
Atherosclerosis 19107500
Cardiovascular diseases 22703625
Dyslipidemia 22703625
   
References
 
Primary:

High serum dehydroepiandrosterone sulfate is associated with phenotypic acne and a reduced risk of abdominal obesity in women with polycystic ovary syndrome.

Chen Mei-Jou, Chen Chin-Der, Yang Jehn-Hsiahn, Chen Chi-Ling, Ho Hong-Nerng, Yang Wei-Shiung, Yang Yu-Shih
Department of Obstetrics and Gynecology, National Taiwan University Hospital, Taipei, Taiwan.
Hum Reprod. 2011 Jan;26(1):227-34. doi: 10.1093/humrep/deq308. Epub 2010 Nov 18.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
CYP21 AND IRS1  
Adrenal androgen excess. 
IRS1 variant and CYP21 mutations 
 
Related 
114 patients and 95 controls  
 
 
Acne and reduced risk of abdominal obesity 
 
Rotterdam criteria 
Related 
Taiwanese-318 PCOS 
The results demonstrated the high serum DHEAS in women with PCOS was associated with the presence of acne and a significantly reduced risk of abdominal obesity, independent of serum testosterone concentration and IR. 
SHBG 
Hyperandrogenism 
 
NIH criteria 
Related 
 
The dexamethasone suppression results in postmenopausal PCOS women suggest that DHEAS and total T are partially of adrenal origin. 
 
Hyperinsulinemia and hyperandrogenism 
 
 
Related 
 
In PCOSd, basal and stimulated DHEAS concentrations were higher during the onset of puberty. 
Insulin-like growth factor-1 
 
 
 
Related 
 
Ovarian stromal blood flow was higher (P<0.01) and uterine perfusion was lower (P<0.01) in women with PCOS compared with women who did not have PCOS. Ovarian stromal artery pulsatility index (PI) was inversely correlated with levels of dehydroepiandrosterone sulfate (DHEAS) and insulin-like growth factor-1, and with the luteinizing hormone/follicle-stimulating hormone ratio. There was a positive correlation between uterine artery PI and DHEAS level. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
25594860, PMC4399300
PAPSS2 deficiency causes androgen excess via impaired DHEA sulfation--in vitro and in vivo studies in a family harboring two novel PAPSS2 mutations. 
In vitro, animal studies 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412