SRD5A2

Gene Information
 
Gene Symbol
SRD5A2
 
Entrez Gene ID
 
Gene Name
Steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
 
Chromosomal Location
2p23.1
 
HGNC ID
 
Summary
This gene encodes a microsomal protein expressed at high levels in androgen-sensitive tissues such as the prostate. The encoded protein is active at acidic pH and is sensitive to the 4-azasteroid inhibitor finasteride. Deficiencies in this gene can result in male pseudohermaphroditism, specifically pseudovaginal perineoscrotal hypospadias (PPSH). (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs523349 AAAACGCTACCTGTGGAAGTAATGTA
C/G
GCAGAAGAGGCCCAGAAGTACCGTC L89V 21530059

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0007267 Biological process Cell-cell signaling TAS 1944596
GO:0008202 Biological process Steroid metabolic process EXP 15583024
GO:0008209 Biological process Androgen metabolic process IDA 1944596
GO:0008584 Biological process Male gonad development IMP 1944596
GO:0009917 Molecular function Sterol 5-alpha reductase activity IDA 1944596
Protein Information
 
Protein Name
3-oxo-5-alpha-steroid 4-dehydrogenase 2
 
Function
Converts testosterone (T) into 5-alpha-dihydrotestosterone (DHT) and progesterone or corticosterone into their corresponding 5-alpha-3-oxosteroids. It plays a central role in sexual differentiation and androgen physiology
 
Refseq Proteins
 
UniProt
 
InterPro
Accessions
IPR001104, IPR016636
 
Pfam
Pfam Accession Pfam ID
PF02544 Steroid_dh 3-oxo-5-alpha-steroid 4-dehydrogenase
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions
STRING MINT I2D
ENSP00000233139

Associated Diseases

Diseases References
Gynecomastia 9467575
Hypospadias 10514539, 20215396, 15266301, 16736621
Polycystic ovary syndrome (PCOS) 10923281, 17603492, 10207720, 9222646, 15855352, 17235527, 15331560, 15657373, 18812636, 22314079, 23685425, 22621829, 20504873, 21270326, 19240152, 17445806, 24040456, 22564702, 22575725, 23748472, 21853931, 22527903, 21827375, 20840271, 20130411, 20045799, 19549442, 18680073, 17141766, 16785159, 16600233, 16316841, 15853827, 15472214, 14671186, 12615821, 11836319, 19681917, 15717879, 15660727, 17420421, 7652727, 15208835, 16980199, 16334591, 18974244, 14764276, 17023708, 15159251, 9590566, 20001427, 19114407, 14976002, 9861517, 8462390, 1736105, 18309108, 17954428, 16506274, 14968294, 12627878, 18779682, 16581078, 9240771, 19138313, 16259222, 12957327, 16054467, 9100707, 17368007, 1457758, 7981184, 10707556, 9270410, 8856394, 12150695, 12692007, 19015938, 18775353, 18640389, 17873318, 17320517, 17183416, 17218834, 15998260, 15579783, 16820727, 16392771, 16319655, 14647894, 14553866, 11997182, 14739074, 12647277, 12408408, 12365467, 10821297, 10440591, 10374288, 8299479, 19149565, 7828781, 2065046, 19572942, 19421860, 19564534, 18927552, 18296327, 17826042, 17760500, 17259501, 16522281, 15075712, 12877091, 12702035, 12675638, 8949974, 19731182, 19164269, 17952838, 16839860, 15590982, 14626524, 12610050, 12540621, 12148078, 10024191, 8964200, 7782801, 20513276, 19369429, 19214921, 18772854, 16697386, 17181562, 15258201, 15047659, 8736268, 19218574, 17083810, 12042261, 9439531, 19947235, 11820995, 15073570, 18486583, 17119001, 17054989, 17341558, 19501863, 16034410, 17656599, 17726085, 18081728, 18381580, 18487287, 17416795, 19537932, 19190263, 17595259, 19003725, 17550959, 18641048, 19501859, 17003346, 18783798, 17875187, 18493106, 18397979, 17721906, 17492427, 20037278, 18052678, 18426837, 18584408, 17970534, 18796616, 18334592, 17890490, 17640906, 19369430, 19264371, 17618858, 17065684, 19215278, 18710473, 17456573, 20222849, 18426814, 17411394, 19088257, 17337499, 18199128, 22397743, 15886251, 20889251, 22068557, 8671472, 11600878, 10418705, 2350207, 11460890, 15638873, 15820714, 20011249, 20406953, 23678035, 24743397, 22238371, 23979790, 16551740, 24969481, 1387563, 1742627, 1327496, 17204352, 11173902, 18050673, 9187410, 10695479, 16039281, 10648020, 16126968, 15311550, 18600083, 20205861, 11567663, 14995993, 11567664, 14678868, 8060375, 11278457, 12728597, 16477805, 15919609, 15380459, 14963283, 14553864, 10208482, 10064006, 9843166, 19918669, 17850750, 12871373, 15080492, 11733024, 11179976, 11129405, 10520809, 10364094, 10980830, 9498632, 14605330, 12911596, 12719278, 12734779, 12195702, 11816701, 11522017, 11373350, 10798278, 9041098, 9005966, 16789641, 15988701, 11092431, 11057874, 10831181, 9734732, 9423801, 9198234, 18501910, 15820196, 14746139, 12891381, 11372681, 10452346, 9622268, 18624608, 17161063, 16128865, 12911589, 11588944, 11525072, 10417403, 9805421, 9161416, 9258409, 19889809, 18559377, 18593221, 16427606, 15630497, 14993864, 9048903, 9031456, 8831916, 18191049, 17014002, 15901895, 15379715, 12921488, 7698502, 7813812, 8241103, 19888787, 19132219, 16939632, 16091487, 15575342, 12723974, 12540956, 11197396, 15516780, 9496335, 15588467, 15333250, 20201644, 15705377, 15598692, 12923954, 16421614, 16087989, 11753584, 16613757, 16757549, 18274928, 17076827, 15080783, 10657556, 16123358, 17892761, 11739453, 18571785, 17322479, 18437347, 12706940, 18220627, 17903275, 14680981, 19652658, 16839844, 16235156, 14698276, 17171553, 16029943, 15893251, 10416955, 19378424, 11445664, 11287357, 19543691, 19774846, 19375766, 15728208, 18319319, 9506738, 12029003, 12205025, 12660878, 12823641, 16550566, 16891032, 20216410, 20228013, 20148136, 19923378, 19875356, 19768241, 18946782, 16835332, 16773588, 18202591, 18253163, 17357288, 17167506, 17172321, 17027526, 16472051, 16567539, 16030153, 18339973, 18093792, 18239554, 18195475, 17267401, 17229078, 16464856, 15999465, 15978151, 15381186, 15181027, 12917504, 12778364, 12690081, 10422520, 20371668, 20131064, 20464701, 16891995, 15633587, 15561970, 20432261, 19875708, 20075410, 19436757, 19455721, 18953360, 18397542, 18923185, 15645209, 15294059, 14555603, 12898289, 12970313, 12734774, 11854119, 11225716, 19747414, 24628003, 2080142, 15024892, 18377903, 16409817, 12450312, 9286726, 16849416, 8871183, 8728917
Pseudohermaphroditism 18097518, 8723114
Virilization 8723114, 14739525, 15813602, 16181229
   
References
 
Primary:

Association of genetic variants in the two isoforms of 5alpha-reductase, SRD5A1 and SRD5A2, in lean patients with polycystic ovary syndrome.

Graupp M, Wehr E, Schweighofer N, Pieber T R, Obermayer-Pietsch B
Department of Endocrinology, Medical University of Graz, Auenbruggerplatz 15, 8036 Graz, Austria. matthias.graupp@stud.medunigraz.at
Eur J Obstet Gynecol Reprod Biol. 2011 Aug;157(2):175-9. Epub 2011 May 6.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
SRD5A1 
 
rs11889731, rs7571644, rs12470143, rs12467911, rs2300697, rs11675297, rs2754530, rs523349 
NIH criteria 
Related 
287 White women with PCOS and 187 controls 
This study presents genetic evidence suggesting an important role of both isoforms of 5alpha-reductase in the pathogenesis of PCOS. That only SRD5A1 haplotypes were associated with hirsutism suggests that only this isoform is important in the hair follicle. 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412