SRD5A1

Gene Information
 
Gene Symbol
SRD5A1
 
Aliases
S5AR 1
 
Entrez Gene ID
 
Gene Name
Steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
 
Chromosomal Location
5p15.31
 
HGNC ID
 
Summary
Steroid 5-alpha-reductase (EC 1.3.99.5) catalyzes the conversion of testosterone into the more potent androgen, dihydrotestosterone (DHT). Also see SRD5A2 (MIM 607306).(supplied by OMIM)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs3797179 AGGACTGCCGCAGGATGCCGAGAAAA
C/T
GCGCCCCCCCACCAGGCTGGGCAGC L89V 21530059

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0007530 Biological process Sex determination NAS 1686016
GO:0008202 Biological process Steroid metabolic process EXP 15583024
GO:0009055 Molecular function Electron carrier activity TAS 1686016
Protein Information
 
Protein Name
Steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
 
Function
Converts testosterone into 5-alpha-dihydrotestosterone and progesterone or corticosterone into their corresponding 5-alpha-3-oxosteroids. It plays a central role in sexual differentiation and androgen physiology
 
Refseq Proteins
 
UniProt
 
InterPro
Accessions
IPR001104, IPR016636
 
Pfam
Pfam Accession Pfam ID
PF02544 Steroid_dh 3-oxo-5-alpha-steroid 4-dehydrogenase
 
KEGG
 
OMIM
 
Interactions
STRING MINT I2D
ENSP00000274192 P18405

Associated Diseases

Diseases References
Acne vulgaris 9068725, 9557222
Cancer (carcinoma) 7707319, 17218080, 8522281
Endocrine disorder 8389478, 12738163
Genitalia external ambiguous 9745434
Hirsutism 16849416
   
References
 
Primary:

5alpha-reductase activity in women with polycystic ovary syndrome.

Jakimiuk A J, Weitsman S R, Magoffin D A
Department of Obstetrics and Gynecology, Second Clinic of Surgical Gynecology, University School of Medicine, Lublin, Poland.
J Clin Endocrinol Metab. 1999 Jul;84(7):2414-8.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
SRD5A2 
hirsutism 
rs472402, rs2677933, rs248805, rs3822430, rs10060745, rs3797179, rs39848 
NIH criteria 
Related 
287 White women with PCOS and 187 controls 
This study presents genetic evidence suggesting an important role of both isoforms of 5alpha-reductase in the pathogenesis of PCOS. That only SRD5A1 haplotypes were associated with hirsutism suggests that only this isoform is important in the hair follicle. 
SRD5A2 
 
SNPs rs39848 and rs3797179 
 
Related 
249 women with PCOS and 226 healthy women 
One of the keys in the development of the PCOS is hyperandrogenism, which might be caused by an increased 5-reductase activity, as it is often seen in obesity. This mechanism might therefore be of importance in lean PCOS patients and contribute to the clinical findings. 
 
 
 
 
Related 
11 PCOS women 
There is a marked increase in 5alphaR metabolism of both C19 and C21 steroids in younger women with PCOS. 
 
 
 
Women with PCOS were identified based on a history of oligo/amenorrhea, hirsutism, and typical morphological appearance of polycystic ovaries (normal or enlarged ovarian volume with multiple subcapsular cysts <8 mm in diameter) at laparotomy or laparoscop 
Direct 
18 PCOS and 26 healthy controls 
 These data demonstrate elevated 5alpha-reductase activity in polycystic ovaries and support the hypothesis that 5alpha-reduced androgens may play a role in the pathogenesis of PCOS. 
POMC and ADIPOQ 
 
 
NIH criteria 
Related 
PCOS (n = 525) and controls (n = 472), aged 18-45 year 
Variants in candidate genes do not seem to be associated with PCOS risk. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
25963796
Circulating gonadotropins and ovarian adiponectin system are modulated by acupuncture independently of sex steroid or ??-adrenergic action in a female hyperandrogenic rat model of polycystic ovary syndrome. 
Animal study 
25130462
Testosterone treatment increases androgen receptor and aromatase gene expression in myotubes from patients with PCOS and controls, but does not induce insulin resistance. 
Clinical study 
24505354, PMC3914883
Quantitative methylation level of the EPHX1 promoter in peripheral blood DNA is associated with polycystic ovary syndrome. 
In vitro 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412