SHBG

Gene Information
 
Gene Symbol
SHBG
 
Aliases
ABP, SBP, TEBG
 
Entrez Gene ID
 
Gene Name
Sex hormone-binding globulin
 
Chromosomal Location
17p13.1
 
HGNC ID
 
Summary
This gene encodes a steroid binding protein that was first described as a plasma protein secreted by the liver but is now thought to participate in the regulation of steroid responses. The encoded protein binds each steroid molecule as a dimer formed from identical or nearly identical monomers. The use of alternate promoters and alternatively spliced transcripts have been described. Multiple transcript variants encoding different isoforms have been found for this gene. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs727428 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT 23001781
rs6259 CTTTGCACTACCTCCCTCTAGGAGAA
A/G
ACTCTTCCACCTCTTTTTGCCTGAA D356N 23001781

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0005576 Cellular component Extracellular region NAS 14718574
GO:0005497 Molecular function Androgen binding TAS 2587256
Protein Information
 
Protein Name
Sex hormone-binding globulin
 
Function
Functions as an androgen transport protein, but may also be involved in receptor mediated processes. Each dimer binds one molecule of steroid. Specific for 5-alpha-dihydrotestosterone, testosterone, and 17-beta-estradiol. Regulates the plasma metabolic clearance rate of steroid hormones by controlling their plasma concentration
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00054 Laminin_G_1 Laminin G domain
 
OMIM
 
Interactions
STRING MINT I2D
ENSP00000369816 P04278

Associated Diseases

Diseases References
Acanthosis nigricans 15623819, 17426408
Anorexia nervosa 11816297, 8770628, 8438764, 7711883
Atherosclerosis 10805491, 11867355, 19808850, 17925335, 7626511
Bone loss 9661081, 17612780, 8799692, 12203037, 1571840, 16767524, 1780668, 15472191, 15886235
Cardiovascular diseases 7626511, 11246820, 9284884, 16757555, 8177048, 10546023, 18956301, 8263149, 11434668, 9440480, 8325960, 1542267, 1894424, 16985482, 8604665, 8768865, 16235154, 9023593, 12640346, 8281222
   
References
 
Primary:

The association of TAAAAn repeat polymorphism in sex hormone-binding protein gene with polycystic ovary syndrome in Chinese population.

Liu Qiaorui, Gu Weiqiong, Cui Bin, Hong Jie, Zhang Yifei, Chi Zhenni, Su Yuxia, Ning Guang
Shanghai Clinical Center for Endocrine and Metabolic Diseases, Shanghai Institute of Endocrinology and Metabolism, Department of Endocrine and Metabolic Diseases, Shanghai JiaoTong University School of Medicine, Shanghai, People's Republic of China.
Endocrine. 2008 Aug-Dec;34(1-3):62-7. Epub 2008 Oct 21.

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26422783
Classic PCOS phenotype is not associated with deficiency of endogenous vitamin D and VDR gene polymorphisms rs731236 (TaqI), rs7975232 (ApaI), rs1544410 (BsmI), rs10735810 (FokI): a case-control study of lower Silesian women. 
Clinical study 
26416764
Causal mechanisms and balancing selection inferred from genetic associations with polycystic ovary syndrome. 
In vitro 
26408006
Comparison of clinical and hormonal characteristics among four phenotypes of polycystic ovary syndrome based on the Rotterdam criteria. 
Clinical study 
26387977
Polycystic ovary syndrome and Metabolic syndrome in Indigenous Australian women. 
Clinical study 
26384059
Serum ferritin levels and polycystic ovary syndrome in obese and nonobese women. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412