SGTA

Gene Information
 
Gene Symbol
SGTA
 
Aliases
SGT, alphaSGT, hSGT
 
Entrez Gene ID
 
Gene Name
Small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
 
Chromosomal Location
19p13
 
HGNC ID
 
Summary
This gene encodes a protein which is capable of interacting with the major nonstructural protein of parvovirus H-1 and 70-kDa heat shock cognate protein; however, its function is not known. Since this transcript is expressed ubiquitously in various tissues, this protein may serve a housekeeping function. (provided by RefSeq, Jul 2008)
 
GeneCards ID
 
UniGene
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs1640262 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT Intron variant 18332089
Protein Information
 
Protein Name
Small glutamine-rich tetratricopeptide repeat-containing protein alpha
 
Function
Co-chaperone that binds directly to HSC70 and HSP70 and regulates their ATPase activity
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00515 TPR_1 Tetratricopeptide repeat
 
OMIM

Associated Diseases

Diseases References
Insulin resistance 18332089
Polycystic ovary syndrome (PCOS) 20200332
   
References
 
Primary:

Small glutamine-rich tetratricopeptide repeat-containing protein alpha (SGTA), a candidate gene for polycystic ovary syndrome.

Goodarzi M O, Xu N, Cui J, Guo X, Chen Y I, Azziz R
Division of Endocrinology, Diabetes and Metabolism, Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA.
Hum Reprod. 2008 May;23(5):1214-9. doi: 10.1093/humrep/den065. Epub 2008 Mar 10.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
Insulin resistance 
SNP rs1640262,haplotype 1 (G-A-T),haplotype 2 (A-G-C) 
NIH criteria 
Related 
 
This study presents genetic evidence suggesting a potential role of SGTA in the pathogenesis of PCOS. SGTA may provide a connection between multiple pathways in PCOS. 
FBN3,ACVR2A, POMC and FEM1B 
 
 
Elevation of circulating androgen levels, either testosterone (T) or nonsex hormone-binding globulin-bound testosterone (uT) associated with chronic oligomenorrhea (6 menses per year) or amenorrhea 
Related 
 
A polymorphic variant, D19S884, in FBN3 is associated with risk of PCOS. POMC is also a candidate gene of interest. SGTA was found to be nominally significant 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
23433514
Small glutamine-rich tetratricopeptide repeat-containing protein alpha is present in human ovaries but may not be differentially expressed in relation to polycystic ovary syndrome. 
In vitro 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412