SERPINA12

Gene Information
 
Gene Symbol
SERPINA12
 
Aliases
OL-64, Vaspin
 
Entrez Gene ID
 
Gene Name
Serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12
 
Chromosomal Location
14q32.13
 
HGNC ID
 
Summary
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs2236242 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT Intron variant 24530312
Protein Information
 
Protein Name
Serpin A12
 
Function
May modulates insulin action conceivably only in the presence of its yet undefined target proteases in white adipose tissues
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
Accessions
IPR000215, IPR023796
 
Pfam
Pfam Accession Pfam ID
PF00079 Serpin Serpin (serine protease inhibitor)
 
OMIM
 
Interactions
STRING MINT I2D
ENSP00000342109 Q8IW75

Associated Diseases

Diseases References
Atherosclerosis 24736484
Diabetes mellitus type 2 25151227, 24732788, 24596079
Immune disorders 25672472, 24596079
Obesity 25151227, 24596079
Polycystic ovary syndrome (PCOS) 21577021
   
References
 
Primary:

Serum vaspin and C-reactive protein levels in women with polycystic ovaries and polycystic ovary syndrome.

Cakal Erman, Ustun Yusuf, Engin-Ustun Yaprak, Ozkaya Mesut, Kilinc Metin
Endocrinology Department, Diskapi Yildirim Beyazit Training and Research Hospital, Ankara, Turkey. ustunyaprak@yahoo.com
Gynecol Endocrinol. 2011 Jul;27(7):491-5. Epub 2010 Jul 13.

The phenotypes of polycystic ovary syndrome defined by the 1990 diagnostic criteria are associated with higher serum vaspin levels than the phenotypes introduced by the 2003 criteria.

Koiou Ekaterini, Dinas Konstantinos, Tziomalos Konstantinos, Toulis Konstantinos, Kandaraki Eleni A, Kalaitzakis Emmanuil, Katsikis Ilias, Panidis Dimitrios
Division of Endocrinology and Human Reproduction, Second Department of Obstetrics and Gynecology, Hippokration Hospital, Thessaloniki, Greece.
Obes Facts. 2011;4(2):145-50. doi: 10.1159/000327935. Epub 2011 Apr 13.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
 
 
Related 
200 PCOS, 50 controls 
PCOS is associated with elevated serum vaspin levels. Moreover, serum vaspin levels reflect the severity of PCOS and are significantly increased in its 'classical' phenotypes. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
24530312
Association between vaspin rs2236242 gene polymorphism and polycystic ovary syndrome risk. 
Clinical study 
22309615
Relationship among plasma adipokines, insulin and androgens level as well as biochemical glycemic and lipidemic markers with incidence of PCOS in women with normal BMI. 
Clinical study 
21325745
The effect of weight loss and treatment with metformin on serum vaspin levels in women with polycystic ovary syndrome. 
Effect of treatment 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412