PPARG

Gene Information
 
Gene Symbol
PPARG
 
Aliases
CIMT1, GLM1, NR1C31, PPARG2, PPARgamma, PPARG
 
Entrez Gene ID
 
Gene Name
Peroxisome proliferator-activated receptor gamma
 
Chromosomal Location
3p25
 
HGNC ID
 
Summary
This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors. PPARs form heterodimers with retinoid X receptors (RXRs) and these heterodimers regulate transcription of various genes. Three subtypes of PPARs are known: PPAR-alpha, PPAR-delta, and PPAR-gamma. The protein encoded by this gene is PPAR-gamma and is a regulator of adipocyte differentiation. Additionally, PPAR-gamma has been implicated in the pathology of numerous diseases including obesity, diabetes, atherosclerosis and cancer. Alternatively spliced transcript variants that encode different isoforms have been described. (provided by RefSeq)
 
GeneCards ID
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs3856806 GACCTCAGACAGATTGTCACGGAACA
C/T
GTGCAGCTACTGCAGGTGATCAAGA Intron variant,synonymous codon,utr variant 3 prime 23748472, 19549442, 22575725
rs1801282 AAACTCTGGGAGATTCTCCTATTGAC
C/G
CAGAAAGCGATTCCTTCACTGATAC Intron variant,missense 24040456, 22564702, 23748472, 22527903, 22575725

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006629 Biological process Lipid metabolic process TAS 9568716
GO:0006917 Biological process Induction of apoptosis IDA 18293083
GO:0006919 Biological process Activation of caspase activity IDA 18293083
GO:0007165 Biological process Signal transduction IDA 9568716
GO:0007584 Biological process Response to nutrient TAS 10973253
Protein Information
 
Protein Name
Peroxisome proliferator-activated receptor gamma
 
Function
Receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Once activated by a ligand, the receptor binds to a promoter element in the gene for acyl-CoA oxidase and activates its transcription. It therefore controls the peroxisomal beta-oxidation pathway of fatty acids. Key regulator of adipocyte differentiation and glucose homeostasis
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00104 Hormone_recep Ligand-binding domain of nuclear hormone receptor
PF00105 zf-C4 Zinc finger, C4 type (two domains)
PF12577 PPARgamma_N Peroxisome proliferator-activated receptor gamma N terminal
PF12577 PPARgamma_N PPAR gamma N-terminal region
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 23697264, 25220536, 24677210, 22344736, 19948072, 19595057, 19107500, 19080630, 18832802, 18334581, 18173145, 17953969, 17488794, 17276431, 15705917, 15498184, 12095507, 11293919, 10588520, 10561001, 9150702, 8034073, 3311782, 24040456, 22564702, 22575725, 23748472, 21853931, 22527903, 21827375, 20840271, 20130411, 20045799, 19549442, 18680073, 17141766, 16785159, 16600233, 16316841, 15853827, 15472214, 14671186, 12615821, 11836319
   
References
 
Primary:

Polymorphism in the peroxisome proliferator-activated receptor-gamma gene in women with polycystic ovary syndrome.

Korhonen S, Heinonen S, Hiltunen M, Helisalmi S, Hippelainen M, Koivunen R, Tapanainen J S, Laakso M
Department of Obstetrics and Gynaecology, Central Hospital of Mikkeli, 50100 Mikkeli, Finland.
Hum Reprod. 2003 Mar;18(3):540-3.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
PGC-1alpha 
PCOS 
PPAR-gammaPro12Ala and the PGC-1alpha Gly482Ser polymorphism 
 
Related 
Korean (184 PCOS and 256 controls)  
PCOS patients, the PPAR-gammaPro12Ala and the PGC-1alpha Gly482Ser polymorphism may modulate the concentrations of serum HDL levels  
FOXO1 and SLC2A4 
Hyperinsulinemic  
 
 
Related 
7 PCOS and 7 Control 
Derepression of PPARG transcription by the high levels of p-FOXO1Ser319 could partially account for the lower levels of SLC2A4 found in PCOSE h-Ins 
 
 
Pro12Ala polymorphism 
 
Related 
54 PCOS and 51 control 
In the PCOS women, a single Ala allele may have a protective role as far as hyperleptinemia is concerned 
 
 
P12A 
NIH criteria 
Related 
120 Chinese women with PCOS and 118 normal subjects 
In PCOS patients, the PPAR-gamma Pro12Ala polymorphism may modulate the concentrations of serum fasting TG levels and fat-deposition in abdomen, respectively 
 
 
P12A 
 
Direct 
2176 cases, 2373 controls 
The meta-analysis study supported thatPPAR- 2 Pro12Ala polymorphism was capable of reducing polycystic ovary syndrome risk in Europeans, but not in Asians 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26246878, PMC4518488
Expression Levels of PPAR?? and CYP-19 in Polycystic Ovarian Syndrome Primary Granulosa Cells: Influence of ??-3 Fatty Acid. 
In vitro 
25702158
Cardiac fatty acid uptake and metabolism in the rat model of polycystic ovary syndrome. 
Animal study 
24649863, PMC4000125
CYP19A1 promoter methylation in saliva associated with milestones of pubertal timing in urban girls. 
Clinical study 
24649096, PMC3917751
Association of PPARG Pro12Ala polymorphism with insulin sensitivity and body mass index in patients with polycystic ovary syndrome. 
Clinical study 
24425206
Expression of PPAR-?? in adipose tissue of rats with polycystic ovary syndrome induced by DHEA. 
Animal study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412