PPARD

Gene Information
 
Gene Symbol
PPARD
 
Aliases
FAAR, NR1C2, NUC1, NUCI, NUCII, PPARB
 
Entrez Gene ID
 
Gene Name
Peroxisome proliferator-activated receptor delta
 
Chromosomal Location
6p21.2
 
HGNC ID
 
Summary
This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) family. PPARs are nuclear hormone receptors that bind peroxisome proliferators and control the size and number of peroxisomes produced by cells. PPARs mediate a variety of biological processes, and may be involved in the development of several chronic diseases, including diabetes, obesity, atherosclerosis, and cancer. This protein is a potent inhibitor of ligand-induced transcription activity of PPAR alpha and PPAR gamma. It may function as an integrator of transcription repression and nuclear receptor signaling. The expression of this gene is found to be elevated in colorectal cancer cells. The elevated expression can be repressed by adenomatosis polyposis coli (APC), a tumor suppressor protein related to APC/beta-catenin signaling pathway. Knockout studies in mice suggested the role of this protein in myelination of the corpus callosum, lipid metabolism, and epidermal cell proliferation. Alternate splicing results in multiple transcript variants. (provided by RefSeq, Jan 2010)
 
GeneCards ID
 
RefSeq DNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs2267668 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT Intron variant 19681917

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006006 Biological process Glucose metabolic process NAS 15793256
GO:0006091 Biological process Generation of precursor metabolites and energy TAS 1333051
GO:0006351 Biological process Transcription, DNA-dependent NAS 11551955
GO:0006355 Biological process Regulation of transcription, DNA-dependent NAS 11551955
GO:0006357 Biological process Regulation of transcription from RNA polymerase II promoter TAS 1333051
Protein Information
 
Protein Name
PPAR-beta, PPAR-delta, nuclear hormone receptor 1, nuclear receptor subfamily 1 group C member 2, peroxisome proliferator-activated nuclear receptor beta/delta variant 2, peroxisome proliferator-activated receptor beta
 
Function
Ligand-activated transcription factor. Receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Has a preference for poly-unsaturated fatty acids, such as gamma-linoleic acid and eicosapentanoic acid. Once activated by a ligand, the receptor binds to promoter elements of target genes. Regulates the peroxisomal beta-oxidation pathway of fatty acids. Functions as transcription activator for the acyl-CoA oxidase gene. Decreases expression of NPC1L1 once activated by a ligand
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00104 Hormone_recep Ligand-binding domain of nuclear hormone receptor
PF00105 zf-C4 Zinc finger, C4 type (two domains)
 
KEGG
 
OMIM

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 19681917
   
References
 
Primary:
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
PPAR-alpha Leu162Val, PPARGC1A, PPAR-gamma2 Pro12Ala and PPAR-gamma2 -681C/G variants 
 
PPAR-delta rs2267668A/G, PPAR-delta-87T/C 
 
Direct 
 
Common polymorphisms in the PPARGC1A, PPAR-delta and PPAR-gamma2 loci are associated with PCOS. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
21106494, PMC3005998
Adiponectin and adiponectin receptors in the mouse preimplantation embryo and uterus. 
Animal study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412