POMC

Gene Information
 
Gene Symbol
POMC
 
Aliases
ACTH, CLIP, LPH, MSH, NPP, POC
 
Entrez Gene ID
 
Gene Name
Proopiomelanocortin
 
Chromosomal Location
2p23
 
HGNC ID
 
Summary
This gene encodes a polypeptide hormone precursor that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the polypeptide precursor and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved in diverse cellular functions. The encoded protein is synthesized mainly in corticotroph cells of the anterior pituitary where four cleavage sites are used; adrenocorticotrophin, essential for normal steroidogenesis and the maintenance of normal adrenal weight, and lipotropin beta are the major end products. In other tissues, including the hypothalamus, placenta, and epithelium, all cleavage sites may be used, giving rise to peptides with roles in pain and energy homeostasis, melanocyte stimulation, and immune modulation. These include several distinct melanotropins, lipotropins, and endorphins that are contained within the adrenocorticotrophin and beta-lipotropin peptides. Mutations in this gene have been associated with early onset obesity, adrenal insufficiency, and red hair pigmentation. Alternatively spliced transcript variants encoding the same protein have been described. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs12473543 AAGGAATAGTTTGGGAAGCTAAAGAT
G/T
TAAAGTACAGAATAGATTGAGGGGT Intron variant 20200332

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006091 Biological process Generation of precursor metabolites and energy IMP 9620771
GO:0007165 Biological process Signal transduction IMP 9620771
GO:0007267 Biological process Cell-cell signaling IMP 9620771
GO:0016486 Biological process Peptide hormone processing EXP 4368999
GO:0032098 Biological process Regulation of appetite IMP 9620771
Protein Information
 
Protein Name
Met-enkephalin
 
Function
ACTH stimulates the adrenal glands to release cortisol|MSH (melanocyte-stimulating hormone) increases the pigmentation of skin by increasing melanin production in melanocytes|Beta-endorphin and Met-enkephalin are endogenous opiates
 
Refseq Proteins
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00976 ACTH_domain Corticotropin ACTH domain
PF08035 Op_neuropeptide Opioids neuropeptide
PF08384 NPP Pro-opiomelanocortin, N-terminal region
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions
STRING MINT I2D
ENSP00000264708 P01189

Associated Diseases

Diseases References
Acth syndrome ectopic 8254033, 7958079, 15845926, 8954027, 7921221, 9519192, 16202863, 9876339, 20133447, 8691671, 8636444, 7883819, 1424185, 7626446, 10195696, 17504182, 1856267, 8381797, 8111702, 10341860, 8800643, 7891545, 8386673, 1652436, 1973178, 14971736, 11443158, 7889616, 16410667, 7629238, 8137518, 11403099, 8636257, 8481335, 11275946, 7615903, 19690085, 8396510
Adrenal androgen excess 14711555
Alcoholism 11955465, 20191296, 11411461, 1975969, 11371718, 18034691, 17503481, 10700840
Cancer (adenoma) 8704030, 7958079, 9876339, 8254033, 8386600, 2159969, 7528607, 10640899, 15692944, 1657597, 10926317, 12582940, 9794723, 9609310, 8245232, 1651583, 18079591, 14971739, 12843142, 15765624, 15089738, 8492226, 16926523, 16625843, 9861319, 7629238, 7699217, 8636444, 1656407, 16940446, 16914081, 16334754, 15578985, 8269424, 16943582, 9167961, 11603575, 12495300, 20041367, 8059845, 9253314, 8784063, 10216530, 1542264, 9794723, 12874666, 2167013, 1651583, 11420487, 15817922, 8704030, 8130885, 10926317, 9876339, 16943582, 9266438, 11579683, 12746561, 17718852, 1668381, 2174003, 1653518, 19697885, 17410413, 1325608, 1718239, 9861319, 7699217, 18209873, 11143249, 9260769, 8998816, 8793326, 16883174, 15227962, 12380732, 10770179, 8383976, 1327071, 2157992, 16400431, 15103224, 12843142, 14558669, 8769379, 8916351, 1319562, 1848486, 9167961, 9487993, 9361580, 19005764, 8162254, 2171814, 18228160, 16444345, 1663149, 1424185, 9143002, 8598995, 9876339, 17100127, 10487094, 7951491, 16926523, 11420487, 10216530, 8769379, 18079591
Cancer (carcinoma) 18713819, 12874666
   
References
 
Primary:

Adrenocortical hyperresponsiveness to corticotropin in polycystic ovary syndrome patients with adrenal androgen excess.

Moran Carlos, Reyna Rosario, Boots Larry S, Azziz Ricardo
Department of Obstetrics and Gynecology, The University of Alabama at Birmingham, Birmingham, Alabama, USA.
Fertil Steril. 2004 Jan;81(1):126-31.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
 
Rotterdam criteria 
Related 
Total of 337 hirsute patients 
Significantly higher ACTH-stimulated levels of cortisol and 17OHP in hirsute patients indicated adrenal hyperresponsiveness in IH and PCOS 
ACVR2A,FEM1B, and SGTA 
 
 
Elevation of circulating androgen levels, either testosterone (T) or nonsex hormone-binding globulin-bound testosterone (uT) associated with chronic oligomenorrhea (6 menses per year) or amenorrhea 
Related 
There was a total of 502 probands and sisters with PCOS. 
The polymorphic variant, D19S884, in FBN3 is associated with risk of PCOS. POMC is also a candidate gene of interest 
5-beta-reductase 
 
 
Rotterdam criteria 
Related 
90 PCOS women (age 18-45 yr) 45 controls  
Adrenal androgen excess in PCOS is associated with increased inactivation of cortisolthat may lower cortisol blood levels and stimulate ACTH-dependent steroidogenesis 
 
Insulin Resistant 
 
 
Related 
20 nonobese PCOS syndrome and 20 control 
 
 
Adrenal androgen excess 
 
NIH criteria 
Related 
PCOS (n = 9) and without (n = 9) AA excess and controls (n = 12) 
Adrenal androgen excess in PCOS is associated with a greater delta 17-OH activity in response to ACTH. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26074346
Peptides: Basic determinants of reproductive functions. 
In vitro 
26061725, PMC4541615
Prenatal Testosterone Treatment Leads to Changes in the Morphology of KNDy Neurons, Their Inputs, and Projections to GnRH Cells in Female Sheep. 
Effect of treatment 
23665441, PMC4130703
Androgen (dihydrotestosterone)-mediated regulation of food intake and obesity in female mice. 
Animal study 
23119079, PMC3485364
Adipocyte dysfunction in a mouse model of polycystic ovary syndrome (PCOS): evidence of adipocyte hypertrophy and tissue-specific inflammation. 
Animal study 
21418339, PMC3939689
Prenatal programming by testosterone of hypothalamic metabolic control neurones in the ewe. 
Animal study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412