MTNR1B

Gene Information
 
Gene Symbol
MTNR1B
 
Aliases
FGQTL2, MEL-1B-R, MT2
 
Entrez Gene ID
 
Gene Name
Melatonin receptor 1B
 
Chromosomal Location
11q21-q22
 
HGNC ID
 
Summary
This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This gene product is an integral membrane protein that is a G-protein coupled, 7-transmembrane receptor. It is found primarily in the retina and brain although this detection requires RT-PCR. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs10830963 AGTGATGCTAAGAATTCACACCATCT
C/G
CTATCCAGAACCAGTAACTGCCTGG Intron variant 20959387

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0007187 Biological process G-protein signaling, coupled to cyclic nucleotide second messenger TAS 7568007
GO:0007268 Biological process Synaptic transmission TAS 7568007
GO:0005887 Cellular component Integral to plasma membrane TAS 7568007
GO:0004930 Molecular function G-protein coupled receptor activity TAS 7568007
Protein Information
 
Protein Name
Melatonin receptor type 1B
 
Function
High affinity receptor for melatonin. Likely to mediates the reproductive and circadian actions of melatonin. The activity of this receptor is mediated by pertussis toxin sensitive G proteins that inhibit adenylate cyclase activity
 
Refseq Proteins
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00001 7tm_1 7 transmembrane receptor (rhodopsin family)
 
KEGG
 
OMIM
 
Interactions
STRING MINT I2D
ENSP00000257068 P49286

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 20959387
Scoliosis idiopathic 17632395
   
References
 
Primary:

Association of rs10830963 and rs10830962 SNPs in the melatonin receptor (MTNR1B) gene among Han Chinese women with polycystic ovary syndrome.

Li Chao, Shi Yuhua, You Li, Wang Laicheng, Chen Zi-Jiang
Shandong Provincial Key Laboratory of Reproductive Medicine, Center for Reproductive Medicine, Provincial Hospital Affiliated to Shandong University, Jinan 250021, China.
Mol Hum Reprod. 2011 Mar;17(3):193-8. Epub 2010 Oct 19.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
SNP, rs10830963 in MTNR1B 
Rotterdam criteria 
Related 
526 patients with PCOS and 547 healthy Chinese Han women 
SNP, rs10830963, in the MTNR1B gene is not only associated with susceptibility to PCOS, but also contributes to the PCOS phenotype 
 
serum testosterone, glucose tolerance, insulin secretion 
 
Rotterdam criteria 
Related 
 
MTNR1B mediating some functions of melatonin contributes to the phenotypic expression ofpolycystic ovary syndrome, which provide a new insight into the role of MTNR1B gene in the pathophysiology of the disease. 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412