MEP1A

Gene Information
 
Gene Symbol
MEP1A
 
Aliases
PPHA
 
Entrez Gene ID
 
Gene Name
Meprin A, alpha (PABA peptide hydrolase)
 
Chromosomal Location
6p12-p11
 
HGNC ID
 
Summary
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs17468190 CGATTACTACGCCTACAGCCCTGTGC
A/G
GGAGCGGGACGCCCACTCCGTCCTC Intron variant,utr variant 3 prime 24388959

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0007586 Biological process Digestion TAS 9288916
GO:0005615 Cellular component Extracellular space TAS 8262185
GO:0005887 Cellular component Integral component of plasma membrane TAS 8262185
GO:0070062 Cellular component Extracellular vesicular exosome IDA 11487543
Protein Information
 
Protein Name
N-benzoyl-L-tyrosyl-P-amino-benzoic acid hydrolase subunit alpha, PABA peptide hydrolase, PPH alpha, bA268F1.1 (meprin A alpha (PABA peptide hydrolase)), endopeptidase-2
 
Function
 
Refseq Proteins
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF01400 Astacin
PF00008 EGF
PF00629 MAM
 
KEGG
 
OMIM

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 24388959
   
References
 
Primary:

Association of MEP1A gene variants with insulin metabolism in central European women with polycystic ovary syndrome.

Lam Uyen D P, Lerchbaum Elisabeth, Schweighofer Natascha, Trummer Olivia, Eberhard Katharina, Genser Bernd, Pieber Thomas R, Obermayer-Pietsch Barbara
Division of Endocrinology and Metabolism, Department of Internal Medicine, Medical University of Graz, Auenbruggerplatz 15, A-8036 Graz, Austria. Electronic address: uyen.lam@medunigraz.at.| Division of Endocrinology and Metabolism, Department of Internal Medicine, Medical University of Graz, Auenbruggerplatz 15, A-8036 Graz, Austria.| Division of Endocrinology and Metabolism, Department of Internal Medicine, Medical University of Graz, Auenbruggerplatz 15, A-8036 Graz, Austria.| Division of Endocrinology and Metabolism, Department of Internal Medicine, Medical University of Graz, Auenbruggerplatz 15, A-8036 Graz, Austria.| Center for Medical Research, Medical University of Graz, Stiftingtalstrasse 24, A-8010 Graz, Austria.| Mannheim Institute of Public Health, Social and Preventive Medicine, Medical Faculty Mannheim, University of Heidelberg, Ludolf-Krehl-Strasse 7-11, D-68167 Mannheim, Germany; Instituto de Saude Coletiva, Federal University of Bahia, Rua Basilio da Gama, Campus Universitario Canela, Cep: 40.110-040 Salvador, BA, Brazil.| Division of Endocrinology and Metabolism, Department of Internal Medicine, Medical University of Graz, Auenbruggerplatz 15, A-8036 Graz, Austria.| Division of Endocrinology and Metabolism, Department of Internal Medicine, Medical University of Graz, Auenbruggerplatz 15, A-8036 Graz, Austria.
Gene. 2014 Mar 10;537(2):245-52. doi: 10.1016/j.gene.2013.12.055. Epub 2014 Jan
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
PCOS, obesity 
rs17468190 
 
Related 
576 PCOS women, 206 controls 
MEP1A gene was more strongly associated with insulin metabolism in overweight/obese PCOS women. MEP1A is a possible target gene for disease modification in PCOS. 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412