MCF2L2

Gene Information
 
Gene Symbol
MCF2L2
 
Aliases
ARHGEF22
 
Entrez Gene ID
 
Gene Name
MCF.2 cell line derived transforming sequence-like 2
 
Chromosomal Location
3q27
 
HGNC ID
 
Summary
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs35368790 AAATAAGTTTATTTCCCCCCGAGGA
C/G
TCTGCTGGTATAACAGATGAGAGAT 19648752
Protein Information
 
Protein Name
MCF2-transforming sequence-like protein 2, dbs-related Rho family guanine nucleotide exchange factor
 
Function
Probably functions as a guanine nucleotide exchange factor (By similarity)
 
Refseq Proteins
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00621 RhoGEF RhoGEF domain
PF13716 CRAL_TRIO_2 Divergent CRAL/TRIO domain
 
OMIM

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 19648752
   
References
 
Primary:

Family-based association study of the MCF2L2 gene and polycystic ovary syndrome.

Zheng Qingmei, Shi Yuhua, Yang Zongli, Xu Xinghua, Wang Laicheng, Xue Fuzhong, Gu Harvest F, Chen Zi-Jiang
Center for Reproductive Medicine, Provincial Hospital, Shandong University, Jinan, China.
Gynecol Obstet Invest. 2009;68(3):171-3. doi: 10.1159/000231520. Epub 2009 Jul
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
SNP variants-rs35368790(associated),[ rs35069869 and rs684846(not associated)] of gene  
 
Related 
Chinese population 
These results suggest that the genetic polymorphisms within MCF2L2 are likely to confer an increased susceptibility to PCOS in the Chinese population. 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412