LPIN1

Gene Information
 
Gene Symbol
LPIN1
 
Aliases
PAP1
 
Entrez Gene ID
 
Gene Name
Lipin 1
 
Chromosomal Location
2p25.1
 
HGNC ID
 
Summary
This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mouse studies suggest that this gene functions during normal adipose tissue development and may also play a role in human triglyceride metabolism. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs11693809 GAGCTGATTTGCATTGGCTCACAAAG
C/T
TGACCACAGACCCTGCATGGGAGAC Intron variant 21448847

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0019432 Biological process Triglyceride biosynthetic process EXP 8944226
Protein Information
 
Protein Name
OTTHUMP00000179151 , Lipin-1 , OTTHUMP00000147624 , DKFZp781P1796 , lipin-1 , lipin 1, PAP1 , OTTHUMP00000179153 , KIAA0188 , phosphatidate phosphatase LPIN1 , EC 3.1.3.4
 
Function
Plays important roles in controlling the metabolism of fatty acids at differents levels. Acts as a magnesium-dependent phosphatidate phosphatase enzyme which catalyzes the conversion of phosphatidic acid to diacylglycerol during triglyceride, phosphatidylcholine and phosphatidylethanolamine biosynthesis in the reticulum endoplasmic membrane. Acts also as a nuclear transcriptional coactivator for PPARGC1A/PPARA to modulate lipid metabolism gene expression (By similarity). Is involved in adipocyte differentiation. May also be involved in mitochondrial fission by converting phosphatidic acid to diacylglycerol (By similarity)
 
Refseq Proteins
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF04571 Lipin_N lipin, N-terminal conserved region
PF08235 LNS2 LNS2 (Lipin/Ned1/Smp2)
 
OMIM
 
Phenotype MIM ID
 
Interactions
STRING MINT I2D
Q14693

Associated Diseases

Diseases References
Cardiometabolic complications 21448847
Obesity 18829900
Polycystic ovary syndrome (PCOS) 21448847, 18829900
   
References
 
Primary:

Lipin 1 gene polymorphisms in polycystic ovary syndrome.

Mlinar B, Ferk P, Pfeifer M, Gersak K, Marc J
Department of Clinical Biochemistry, Faculty of Pharmacy, University of Ljubljana, Ljubljana, Slovenia. barbara.mlinar@ff a.uni-lj.si
Horm Metab Res. 2011 Jun;43(6):427-32. Epub 2011 Mar 29.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
Peroxisome proliferator-activated receptor gamma, lipoprotein lipase, hormone-sensitive lipase, adiponectin and glucose transporter 4 in subcutaneous and visceral adipose tissue 
Obesity and Insulin resistance 
 
 
Related 
85 PCOS patients and 44 controls 
Lipin 1beta appears to be involved in the pathogenesis of IR in PCOS. 
IR 
Cardiometabolic complications 
rs11693809 (intron 1 SNP) and rs2716610 (intron 17 SNP) 
 
Related 
222 PCOS patients and 149 controls 
Genotype and allele frequencies were similar between PCOS patients and controls for both SNPs. Our results show that, in PCOS patients, intron 1 SNP is protective against IR and glucose intolerance suggesting that lipin 1 variation could be one of the genetic factors in cardiometabolic complications of PCOS. 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412