LHCGR

Gene Information
 
Gene Symbol
LHCGR
 
Aliases
HHG, LCGR, LGR2, LH/CG-R, LH/CGR, LHR, LHRHR, LSH-R, ULG5
 
Entrez Gene ID
 
Gene Name
Luteinizing hormone/choriogonadotropin receptor
 
Chromosomal Location
2p21
 
HGNC ID
 
Summary
This gene encodes the receptor for both luteinizing hormone and choriogonadotropin. This receptor belongs to the G-protein coupled receptor 1 family, and its activity is mediated by G proteins which activate adenylate cyclase. Mutations in this gene result in disorders of male secondary sexual character development, including familial male precocious puberty, also known as testotoxicosis, hypogonadotropic hypogonadism, Leydig cell adenoma with precocious puberty, and male pseudohermaphtoditism with Leydig cell hypoplasia. (provided by RefSeq, Jul 2008)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs13405728 ATTCCTGCTGGTCTTGGTTAGTACCA
C/T
TCAATAAAATGTTAGGACCCGGGCT Intron variant 25978310, 21151128
rs7371084 GGACTGCAGGGCGCTCACGCTTGCTG
C/T
GAAGTAAGGCGTTTGAAGGTGAGGC Intron variant 25649397
rs4953616 GGACTGCAGGGCGCTCACGCTTGCTG
C/T
GAAGTAAGGCGTTTGAAGGTGAGGC Intron variant 25649397

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0007186 Biological process G-protein coupled receptor signaling pathway TAS 9626653
GO:0007187 Biological process G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger TAS 7719343
GO:0008584 Biological process Male gonad development TAS 7719343
GO:0030539 Biological process Male genitalia development TAS 9626653
GO:0005768 Cellular component Endosome TAS 10617611
Protein Information
 
Protein Name
Lutropin-choriogonadotropic hormone receptor
 
Function
Receptor for lutropin-choriogonadotropic hormone. The activity of this receptor is mediated by G proteins which activate adenylate cyclase
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00001 7tm_1 7 transmembrane receptor (rhodopsin family)
PF13306 LRR_5 Leucine rich repeats (6 copies)
 
KEGG
 
OMIM
 
Phenotype MIM ID

Associated Diseases

Diseases References
Anovulation 24830504
Azoospermia 16730882
Cancer (adenoma) 11696538, 16332935, 11861529, 11857565
Cancer (carcinoma) 12779076, 8895668, 10914722
Hypogonadism 10714363, 19129711
   
References
 
Primary:

The 312N variant of the luteinizing hormone/choriogonadotropin receptor gene (LHCGR) confers up to 2.7-fold increased risk of polycystic ovary syndrome in a Sardinian population.

Capalbo A, Sagnella F, Apa R, Fulghesu A M, Lanzone A, Morciano A, Farcomeni A, Gangale M F, Moro F, Martinez D, Ciardulli A, Palla C, Uras M L, Spettu F, Cappai A, Carcassi C, Neri G, Tiziano F D
Istituto di Genetica Medica, Universita Cattolica del Sacro Cuore, Roma, Italy.
Clin Endocrinol (Oxf). 2012 Jul;77(1):113-9. doi:
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
rs7562215, rs10495960, rs13405728, rs35960650, rs2956355, and rs7562879 
NIH criteria 
Direct 
905 women with PCOS, 956 control women  
Fine mapping of the chromosome 2p16.3 Chinese PCOS susceptibility locus in a European ancestry cohort provides evidence for association with two independent loci and PCOS. The gene products LHCGR and FSHR therefore are likely to be important in the etiology of PCOS, regardless of ethnicity 
CYP17A1 
 
 
Rotterdam criteria 
Related 
16 PCO, 10 controls 
LHCGR and 17 -hydroxylase/17-20-lyase (CYP17A1) protein levels are increased in polycystic ovaries (PCOs) 
 
PCOS 
G935A 
 
Direct 
100 women with PCOS, 60 healthy female controls 
These results may provide an opportunity to test this SNP at the LHCGR gene in fertile or infertile women with family history to assess their risk of PCOS 
THADA, DENND1A, FSHR, c9orf3, YAP1, RAB5B/SUOX, HMGA2, TOX3, INSR, SUMO1P1 
PCOS 
 
Rotterdam criteria 
Direct 
192 women with PCOS, and no novel somatic mutations, 85 women with PCOS and 88 control women 
The tendency of LHCGR to be hypomethylated across different tissues and its corresponding expression level suggest that hypomethylation of LHCGR is a potential mechanism underlying susceptibility to PCOS 
THADA, DENND1A, FSHR, c9orf3, YAP1, RAB5B/SUOX, HMGA2, TOX3, INSR, SUMO1P1 
 
rs13405728 
Rotterdam criteria 
Direct 
703 Dutch PCOS patients and 2164 Dutch controls 
This study identifies 12 genetic variants mapping to the Chinese PCOS loci similar effect size and identical direction in PCOS patients from Northern European ancestry, indicating a common genetic risk profile for PCOS across populations 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
25978310, PMC4433204
Association Study between Polycystic Ovarian Syndrome and the Susceptibility Genes Polymorphisms in Hui Chinese Women. 
Clinical study 
25835506
Pathogenesis of polycystic ovary syndrome: multifactorial assessment from the foetal stage to menopause. 
Animal study 
25649397, PMC4380895
Leutinizing hormone/choriogonadotropin receptor and follicle stimulating hormone receptor gene variants in polycystic ovary syndrome. 
Clinical study 
25586784
Polycystic ovary syndrome susceptibility single nucleotide polymorphisms in women with a single PCOS clinical feature. 
Clinical study 
25565299, PMC4361359
Association of luteinizing hormone chorionic gonadotropin receptor gene polymorphism (rs2293275) with polycystic ovarian syndrome. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412