LHB

Gene Information
 
Gene Symbol
LHB
 
Aliases
CGB4, HH23, LSH-B, hLHB
 
Entrez Gene ID
 
Gene Name
Luteinizing hormone beta polypeptide
 
Chromosomal Location
19q13.3
 
HGNC ID
 
Summary
This gene is a member of the glycoprotein hormone beta chain family and encodes the beta subunit of luteinizing hormone (LH). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. LH is expressed in the pituitary gland and promotes spermatogenesis and ovulation by stimulating the testes and ovaries to synthesize steroids. The genes for the beta chains of chorionic gonadotropin and for luteinizing hormone are contiguous on chromosome 19q13.3. Mutations in this gene are associated with hypogonadism which is characterized by infertility and pseudohermaphroditism. (provided by RefSeq, Jul 2008)
 
GeneCards ID
 
UniGene
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs34349826 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT I35T 25111116
rs1800447 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT W28R 25111116
rs34349826 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT I35T 25111116

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006701 Biological process Progesterone biosynthetic process TAS 14557487
GO:0007165 Biological process Signal transduction TAS 10484773
GO:0007267 Biological process Cell-cell signaling TAS 10484773
GO:0008584 Biological process Male gonad development TAS 6785294
GO:0005102 Molecular function Receptor binding TAS 10484773
Protein Information
 
Protein Name
Lutropin subunit beta
 
Function
Promotes spermatogenesis and ovulation by stimulating the testes and ovaries to synthesize steroids
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00007 Cys_knot Cystine-knot domain
 
KEGG
 
OMIM

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 22209983
   
References
 
Primary:

Role of luteinizing hormone beta-subunit gene variants among South Indian women with polycystic ovary syndrome.

Dasgupta Shilpi, Sirisha P V S, Neelaveni K, Anuradha K, Sudhakar G, Reddy B Mohan
Molecular Anthropology Group, Biological Anthropology Unit, Indian Statistical Institute, Hyderabad, Andhra Pradesh, India.
Gene. 2012 Feb 15;494(1):51-6. doi: 10.1016/j.gene.2011.11.054. Epub 2011 Dec 20.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
SNP in exon 3 (rs#1056917) of LH gene 
 
Related 
South-Indian-250 PCOS and 299 controls 
The LH variants that are found to be more frequent among PCOS cases are silent in nature and not of any functional significance, they might influence other significant functional polymorphisms in the hypothalamic-pituitary-gonadal axis which needs to be explored. 
 
PCOS 
 
 
Related 
50 PCOS, 30 controls 
Women with the PCOS had significantly higher mean arterial pressure (MAP), serum TAG, LDL-C, insulin, and LH levels when compared with the age-matched control subjects 
 
 
 
 
Related 
40 (20 PCO, 10 chronic anovulation, 10 controls) 
This data suggest that bioactive LH may be an important hormonal marker in the clinical diagnosis of PCO 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26203175
A Novel Letrozole Model Recapitulates Both the Reproductive and Metabolic Phenotypes of Polycystic Ovary Syndrome in Female Mice. 
Animal study 
25299229
Sertoli-Leydig cell tumors: hormonal profile after dynamic test with GnRH analogue: triptorelin represents a useful tool to evaluate tumoral hyperandrogenism. 
In vitro 
25111116
Trp28Arg/Ile35Thr LHB gene variants are associated with elevated testosterone levels in women with polycystic ovary syndrome. 
Clinical study 
24056171, PMC3947649
GnRH pulse frequency-dependent differential regulation of LH and FSH gene expression. 
In vitro 
23764390
Potential role and therapeutic interests of myo-inositol in metabolic diseases. 
Effect of treatment 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412