IRS4

Gene Information
 
Gene Symbol
IRS4
 
Aliases
IRS-4, PY160
 
Entrez Gene ID
 
Gene Name
Insulin receptor substrate 4
 
Chromosomal Location
Xq22.3
 
HGNC ID
 
Summary
IRS4 encodes the insulin receptor substrate 4, a cytoplasmic protein that contains many potential tyrosine and serine/threonine phosphorylation sites. Tyrosine-phosphorylated IRS4 protein has been shown to associate with cytoplasmic signalling molecules that contain SH2 domains. The IRS4 protein is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation.. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs1865434 GAGTCGATGAGGGTGTGCTCCATGGT
C/T
GGTCTTCCTTGCCAGCTGATGCCCA Utr variant 3 prime 21300347

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0007165 Biological process Signal transduction TAS 9261155
GO:0005070 Molecular function SH3/SH2 adaptor activity TAS 9261155
Protein Information
 
Protein Name
Insulin receptor substrate 4
 
Function
Acts as an interface between multiple growth factor receptors possessing tyrosine kinase activity, such as insulin receptor, IGF1R and FGFR1, and a complex network of intracellular signaling molecules containing SH2 domains. Involved in the IGF1R mitogenic signaling pathway. Promotes the AKT1 signaling pathway and BAD phosphorylation during insulin stimulation without activation of RPS6KB1 or the inhibition of apoptosis. Interaction with GRB2 enhances insulin-stimulated mitogen-activated protein kinase activity. May be involved in nonreceptor tyrosine kinase signaling in myoblasts. Plays a pivotal role in the proliferation/differentiation of hepatoblastoma cell through EPHB2 activation upon IGF1 stimulation. May play a role in the signal transduction in response to insulin and to a lesser extent in response to IL4 and GH on mitogenesis. Plays a role in growth, reproduction and glucose homeostasis. May acts as negative regulators of the IGFI signaling pathway by suppressing the function of IRS1 and IRS2
 
Refseq Proteins
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF02174 IRS PTB domain (IRS-1 type)
 
KEGG
 
OMIM
 
Interactions

Associated Diseases

Diseases References
Hyperandrogenism 15155816
Polycystic ovary syndrome (PCOS) 22945299
   
References
 
Primary:

Selective alterations in insulin receptor substrates-1, -2 and -4 in theca but not granulosa cells from polycystic ovaries.

Yen H-W, Jakimiuk A J, Munir I, Magoffin D A
Department of Obstetrics and Gynecology, Cedars-Sinai Burns and Allen Research Institute, Cedars-Sinai Medical Center/The David Geffen School of Medicine at UCLA, 8700 Beverly Blvd., Davis 2066, Los Angeles, CA 90048, USA.
Mol Hum Reprod. 2004 Jul;10(7):473-9. Epub 2004 May 21.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
hyperandrogenism and thecal hyperplasia 
 
Women with PCOS were identified based on a history of oligo/amenorrhoea, hirsutism, and typical morphological appearance of polycystic ovaries (normal or enlarged ovarian volume with multiple subcapsular cysts (8mm in diameter) at laparotomy or laparosco 
Related 
11 women with PCOS and 10 regularly cycling control women 
The data demonstrates cell-specific alterations in IRS protein concentrations in theca cells from polycystic ovaries that are consistent with an exaggerated amplification of the insulin signal and which may play an important role in ovarian hyperandrogenism and thecal hyperplasia. 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412