IRS2

Gene Information
 
Gene Symbol
IRS2
 
Aliases
IRS-2
 
Entrez Gene ID
 
Gene Name
Insulin receptor substrate 2
 
Chromosomal Location
13q34
 
HGNC ID
 
Summary
This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs7997595 TCATGTGACTTTCATTCACGAAAGCC
C/G
GTGTGTGTTTTCATTAGCACCTTAG Intron variant 21300347

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006006 Biological process Glucose metabolic process TAS 9495343
GO:0007165 Biological process Signal transduction TAS 7675087
GO:0008284 Biological process Positive regulation of cell proliferation NAS 17925406
GO:0010748 Biological process Negative regulation of plasma membrane long-chain fatty acid transport IMP 16814735
GO:0010907 Biological process Positive regulation of glucose metabolic process IMP 16814735
Protein Information
 
Protein Name
Insulin receptor substrate 2
 
Function
May mediate the control of various cellular processes by insulin
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00169 PH PH domain
PF02174 IRS PTB domain (IRS-1 type)
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions

Associated Diseases

Diseases References
Atherosclerosis 17127239, 18802016, 18506362
Bone loss age-related 15576984, 15651373
Cancer (carcinoma) 17030605, 11488908, 19920186
Diabetes gestational 10973656
Obesity 12687350, 16652127, 20184486, 16086274, 17098372, 17925332, 19223519, 17020651, 19818665
   
References
 
Primary:

Study of association of IRS-1 and IRS-2 genes polymorphisms with clinical and metabolic features in women with polycystic ovary syndrome. Is there an impact?

Christopoulos Panagiotis, Mastorakos George, Gazouli Maria, Deligeoroglou Efthymios, Katsikis Ilias, Diamanti-Kandarakis Evanthia, Panidis Dimitrios, Creatsas George
Division of Pediatric-Adolescent Gynecology and Reconstructive Surgery, 2nd Department of Obstetrics and Gynecology, Medical School, University of Athens, Athens, Greece. dr_christopoulos@yahoo.gr
Gynecol Endocrinol. 2010 Sep;26(9):698-703.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
IRS-1 
 
G972A variant 
PCOS was defined by oligo-ovulation, clinical and/or biochemical hyperandrogenism and exclusion of hyperprolactinaemia (serum prolactin <24 µg/l), non-classic congenital adrenal hyperplasia [adrenocorticotrophic hormone (ACTH)-stimulated 17-hydroxyproges 
Related 
Spanish PCOS (n = 103) women compared with a control group (n = 48)  
The Gly972Arg in IRS-1 and Gly1057Asp in IRS-2 polymorphisms influence glucose homeostasis in premenopausal women, but are not associated with PCOS. 
 
 
 
 
Direct 
insulin resistance (n = 19), PCOS without insulin resistance (n = 17) and controls (n = 20) 
The decrease of tyrosine phosphorylation of IRS-2 in PCOS patients, which induces impairment of the insulin signal pathway, may be one of the mechanisms leading to insulin resistance. 
GSK-3  
 
variants in genes  
Rotterdam criteria 
Related 
273 cases with PCOS and 173 control cohort; and 526 cases and 3585 control subjects in the replication cohort 
A pathway-based tagging SNP approach allowed us to identify novel INSR SNPs associated with PCOS, one of which confirmed association in a large replication cohort. 
IRS-1 
 
 
NIH criteria 
Related 
48 Iranian women diagnosed withPCOS were enrolled and 52 control 
Considering that no association between the IRS-1 Gly972Arg and IRS-2 Gly1057Asp polymorphisms and PCOS were found, the results confirm that these polymorphisms should not be considered as major contributors to the pathogenesis of this disorder. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
25310961, PMC4203877
Association of Gly972Arg variant of insulin receptor subtrate-1 and Gly1057Asp variant of insulin receptor subtrate-2 with polycystic ovary syndrome in the Chinese population. 
Clinical study 
24390626, PMC3947080
Altered microRNA and gene expression in the follicular fluid of women with polycystic ovary syndrome. 
In vitro 
23426873
Prenatal androgen excess programs metabolic derangements in pubertal female rats. 
Animal study 
22076926, PMC3237653
Reproductive tissues maintain insulin sensitivity in diet-induced obesity. 
Effect of treatment 
21801267
Interleukin-6 as an early chronic inflammatory marker in polycystic ovary syndrome with insulin receptor substrate-2 polymorphism. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412