INSR

Gene Information
 
Gene Symbol
INSR
 
Aliases
CD220, HHF5
 
Entrez Gene ID
 
Gene Name
Insulin receptor
 
Chromosomal Location
19p13.3-p13.2
 
HGNC ID
 
Summary
After removal of the precursor signal peptide, the insulin receptor precursor is post-translationally cleaved into two chains (alpha and beta) that are covalently linked. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. Two transcript variants encoding different isoforms have been found for this gene. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs2252673 ATGCCTCGGAGAACCCAGGGGTTTCT
C/G
TGGCTTTTTGCATGCGGCGGGCAGC Intron variant 24947064, 21300347
rs12459488 TGTCTAACTCATCATCCCAGATTATT
C/T
TGAAGTGGAAACCACCCTCCGACCC Intron variant 21300347
rs12971499 TGTCTAACTCATCATCCCAGATTATT
C/T
TGAAGTGGAAACCACCCTCCGACCC Intron variant 21300347
rs10401628 ATGCCTCGGAGAACCCAGGGGTTTCT
C/G
TGGCTTTTTGCATGCGGCGGGCAGC Intron variant 21300347
rs2963 TGTCTAACTCATCATCCCAGATTATT
C/T
TGAAGTGGAAACCACCCTCCGACCC Synonymous codon 20493471

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0000187 Biological process Activation of MAPK activity IMP 17001305
GO:0001934 Biological process Positive regulation of protein phosphorylation IDA 7556070
GO:0003007 Biological process Heart morphogenesis IMP 7693131
GO:0006355 Biological process Regulation of transcription, DNA-dependent IMP 12881524
GO:0007186 Biological process G-protein coupled receptor protein signaling pathway IDA 9092559
Protein Information
 
Protein Name
Insulin receptor
 
Function
This receptor binds insulin and has a tyrosine-protein kinase activity. Isoform Short has a higher affinity for insulin. Mediates the metabolic functions of insulin. Binding to insulin stimulates association of the receptor with downstream mediators including IRS1 and phosphatidylinositol 3'-kinase (PI3K). Can activate PI3K either directly by binding to the p85 regulatory subunit, or indirectly via IRS1. When present in a hybrid receptor with IGF1R, binds IGF1. PubMed:12138094 shows that hybrid receptors composed of IGF1R and INSR isoform Long are activated with a high affinity by IGF1, with low affinity by IGF2 and not significantly activated by insulin, and that hybrid receptors composed of IGF1R and INSR isoform Short are activated by IGF1, IGF2 and insulin. In contrast, PubMed:16831875 shows that hybrid receptors composed of IGF1R and INSR isoform Long and hybrid receptors composed of IGF1R and INSR isoform Short have similar binding characteristics, both bind IGF1 and have a low affinity for insulin
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00041 fn3 Fibronectin type III domain
PF00757 Furin-like Furin-like cysteine rich region
PF01030 Recep_L_domain Receptor L domain
PF07714 Pkinase_Tyr Protein tyrosine kinase
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions

Associated Diseases

Diseases References
Acanthosis nigricans 9104736, 2180980, 8621823, 9872020, 8456839, 8314008, 2215248, 15232309, 11595827, 2101060, 9352137, 2128692
Autoimmunity 18556968, 1944313, 10665336
Cancer (adenoma) 17416760, 8180417
Cancer (carcinoma) 12193537, 12599422
Diabetes mellitus 2194201, 11887975, 10436971, 2264326, 8107939, 7798769, 7599691, 2284806, 7983787, 9634724, 19948975, 12537988, 1375070, 11189234, 7814014, 7879290, 7944536, 8106637, 7684396, 8477820, 17674807, 15010337, 12707268, 9472957, 8456839, 17275003, 7865816, 12470244, 17986027
   
References
 
Primary:

Altered autophosphorylation of the insulin receptor in the ovary of a woman with polycystic ovary syndrome.

Moran C, Huerta R, Conway-Myers B A, Hines G A, Azziz R
Department of Obstetrics and Gynecology, The University of Alabama at Birmingham, Birmingham, Alabama, USA.
Fertil Steril. 2001 Mar;75(3):625-8.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
GSK-3  
 
295 INSR SNPs 
Rotterdam criteria 
Related 
273 cases with PCOS and 173 control subjects in the discovery cohort; and 526 cases and 3,585 control subjects 
A pathway-based tagging SNP approach allowed us to identify novel INSR SNPs associated with PCOS 
 
 
rs2252673 
 
Direct 
224 women with PCOS, 192 controls and 672 participants consisting of 224 trios (mother, father and offspring with PCOS)  
There were a association between the SNP variant rs2252673 of INSR gene and the susceptibility to PCOS in Han Chinese women, which was independently of body mass index. 
 
 
rs3786681, rs17253937 and rs2252673 
 
Direct 
224 family trios (672 participants in total) 
A weak association was detected in rs2252673 (P = 0.027), which indicated that INSR may confer an increased susceptibility to PCOS in Chinese. 
 
 
 
Rotterdam criteria 
Related 
60 family trios were recruited 
No significant evidence of association or linkage was found 
Insulin resistance 
Methylation in women 
 
 
Related 
35 patients with PCOS were divided into insulin resistant group (IR group, n=18) and non-resistant group (NIR group, n=18) 
Partial methylation of the INSR gene occurs in the endometria of PCOS patients 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26312838
Effect of insulin on AKR1C3 expression in female adipose tissue: in-vivo and in-vitro study of adipose androgen generation in polycystic ovary syndrome. 
In vitro 
26179926
Potent therapeutic effects of Shouwu Jiangqi Decoction () on polycystic ovary syndrome with insulin resistance in rats. 
Animal study 
26045896, PMC4448196
Reversing the reduced level of endometrial GLUT4 expression in polycystic ovary syndrome: a mechanistic study of metformin action. 
Effect of treatment 
26020622
Zinc supplementation for the prevention of type 2 diabetes mellitus in adults with insulin resistance. 
Effect of treatment 
25927028, PMC4386084
An Association Study between INSR/NsiI (rs2059806) and INSR/PmlI (rs1799817) SNPs in Women with Polycystic Ovary Syndrome from West Azerbaijan Province, Iran. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412