IDE

Gene Information
 
Gene Symbol
IDE
 
Aliases
INSULYSIN
 
Entrez Gene ID
 
Gene Name
Insulin-degrading enzyme
 
Chromosomal Location
10q23-q25
 
HGNC ID
 
Summary
This gene encodes a zinc metallopeptidase that degrades intracellular insulin, and thereby terminates insulins activity, as well as participating in intercellular peptide signalling by degrading diverse peptides such as glucagon, amylin, bradykinin, and kallidin. The preferential affinity of this enzyme for insulin results in insulin-mediated inhibition of the degradation of other peptides such as beta-amyloid. Deficiencies in this protein's function are associated with Alzheimer's disease and type 2 diabetes mellitus but mutations in this gene have not been shown to be causitive for these diseases. This protein localizes primarily to the cytoplasm but in some cell types localizes to the extracellular space, cell membrane, peroxisome, and mitochondrion. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but have not been experimentally verified.
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs2209972 GGACTGCAGGGCGCTCACGCTTGCTG
C/T
GAAGTAAGGCGTTTGAAGGTGAGGC Nc transcript variant 17953957

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006508 Biological process Proteolysis TAS 9830016
GO:0007165 Biological process Signal transduction TAS 2293021
GO:0007548 Biological process Sex differentiation TAS 8425612
GO:0010815 Biological process Bradykinin catabolic process IDA 17613531
GO:0050435 Biological process Beta-amyloid metabolic process IDA 17613531
Protein Information
 
Protein Name
Insulysin , insulin protease , OTTHUMP00000020097 , FLJ35968 , Insulin protease , insulin-degrading enzyme, insulinase , INSULYSIN , Abeta-degrading protease , Insulinase , EC 3.4.24.56
 
Function
Plays a role in the cellular breakdown of insulin, IAPP, glucagon, bradykinin, kallidin and other peptides, and thereby plays a role in intercellular peptide signaling. Degrades amyloid formed by APP and IAPP. May play a role in the degradation and clearance of naturally secreted amyloid beta-protein by neurons and microglia
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00675 Peptidase_M16 Insulinase (Peptidase family M16)
PF05193 Peptidase_M16_C Peptidase M16 inactive domain
 
KEGG
 
OMIM
 
Interactions
STRING MINT I2D
ENSP00000265986 P14735

Associated Diseases

Diseases References
Acanthosis nigricans 16499154, 15733362, 19348659, 1304190, 1316928, 15265420, 1612555, 8621823, 15186199, 16302580, 8172227, 19242280, 8303114, 1607489, 2101060, 11573555, 2138630, 2217009, 7662572, 9872020, 18492785, 8469481, 14651545, 16385761, 15919811, 11860562, 11428078, 10231062, 9578241, 2075024, 7852529, 14715828, 2215248, 2180980, 16435040, 15802076, 15232309, 11436180, 11595827, 8458461, 18397315, 16873592, 16824934, 15161797, 12425366, 10325466, 7951506, 2095357, 18700035, 17656880, 8288049, 1588128, 2137793, 15889115, 1497426, 2407584, 8390949, 8136544, 18639784, 17590683, 17322752, 16224320, 15070911, 11916958, 11907848, 11328611, 11168330, 7983791, 7914241, 8021347, 1563582, 1874935, 1846830, 20374339, 20046314, 19762579, 18041775, 17894521, 16610614, 17039177, 15790014, 15256325, 12180897, 11244342, 10914675, 9920060, 10987057, 7860063, 7809540, 7977931, 8456839, 1590285, 1955101, 2035982, 2002058, 20333871, 18669553, 18556968, 10883089
Alzheimers disease 10213160, 15277615, 16894402, 16876916
Anovulation 10469683, 12466374, 8773746, 17547089, 10920084, 9429864, 8550768, 18602948, 12908341, 10352923, 1742883, 8222298, 17145645, 18639784, 2205423, 11284649, 16444364, 18729532, 16522691, 12626141, 12517726, 7600112, 2058954, 19906783, 19279033, 18181079, 16899578, 15292314, 15206484, 12917943, 19470707, 18505468, 18552753, 14617367, 14512432, 19821299, 19344852, 18382906, 16219952, 14973408, 15255372, 12502516, 9856413, 9741712, 15846568, 15380144, 12770812, 12199044, 10720029, 9177365, 8626868, 20092643, 19370625, 19413702, 19522426, 19405411, 19078872, 18844713, 17185789, 16728382, 16338908, 16309038, 17426408, 16790096, 12161543, 12017950, 10726907, 9823701, 7990713, 1283982, 8388405, 15767238, 19027112, 19243754, 19212122, 18799960, 18460940, 16263811, 11561739, 7825639, 1471702, 19782351, 20091537, 20067879, 19588338, 19243758, 16606451, 9177364, 19141577, 17984248, 11836287, 11293003, 10456184
Autoimmune diseases 2183533, 17110897, 9497784, 1618597, 8009085, 9480718, 2139376, 2135382, 2134205, 1608603, 8297523, 7508271, 7538087, 7788961, 8531840, 8574515, 8612195, 8672555, 8870437, 9209509, 9278178, 9498634, 9566861, 18928561, 9588275, 9725265, 9752116, 9820109, 10680451, 10225827, 10425571, 10884183, 10330300, 10587728, 9307889, 9267837, 9200922, 9054945, 9254534, 8764139, 8608726, 19299910, 19111165, 19052699, 17465749, 15690345, 15564440, 14593308, 14510692, 12848947, 9453293, 9288224, 8937685, 8912862, 8674148, 8781713, 7584694, 7555564, 8585195, 11510622, 10323367, 9589653, 9348670, 7958108, 7678356, 1722982, 2291624, 1975778, 20415859, 19969107, 20155453, 12593282, 12570678, 12516290, 11407307, 11145035, 10618410, 10523611, 10372542, 7889706, 8297521, 1478150, 1932705, 2012115, 1966582, 19631771, 19447046, 11021593, 11138783, 11218965, 11168337, 11552003, 12173683, 12391226, 15104670, 15115315, 15154614, 15472233, 15677401
Cardiovascular diseases 10923281, 17603492, 10207720, 9222646, 15855352, 17235527, 15331560, 15657373, 18812636, 22314079, 23685425, 22621829, 20504873, 21270326, 19240152, 17445806, 24040456, 22564702, 22575725, 23748472, 21853931, 22527903, 21827375, 20840271, 20130411, 20045799, 19549442, 18680073, 17141766, 16785159, 16600233, 16316841, 15853827, 15472214, 14671186, 12615821, 11836319, 19681917, 15717879, 15660727, 17420421, 7652727, 15208835, 16980199, 16334591, 18974244, 14764276, 17023708, 15159251, 9590566, 20001427, 19114407, 14976002, 9861517, 8462390, 1736105, 18309108, 17954428, 16506274, 14968294, 12627878, 18779682, 16581078, 9240771, 19138313, 16259222, 12957327, 16054467, 9100707, 17368007, 1457758, 7981184, 10707556, 9270410, 8856394, 12150695, 12692007, 19015938, 18775353, 18640389, 17873318, 17320517, 17183416, 17218834, 15998260, 15579783, 16820727, 16392771, 16319655, 14647894, 14553866, 11997182, 14739074, 12647277, 12408408, 12365467, 10821297, 10440591, 10374288, 8299479, 19149565, 7828781, 2065046, 19572942, 19421860, 19564534, 18927552, 18296327, 17826042, 17760500, 17259501, 16522281, 15075712, 12877091, 12702035, 12675638, 8949974, 19731182, 19164269, 17952838, 16839860, 15590982, 14626524, 12610050, 12540621, 12148078, 10024191, 8964200, 7782801, 20513276, 19369429, 19214921, 18772854, 16697386, 17181562, 15258201, 15047659, 8736268
   
References
 
Primary:

Association of genetic variants of insulin degrading enzyme with metabolic features in women with polycystic ovary syndrome.

Wang Kehua, You Li, Shi Yuhua, Wang Laicheng, Zhang Meixin, Chen Zi-Jiang
Center for Reproductive Medicine, Shandong Provincial Hospital, Shandong University, Jinan, the People's Republic of China.
Fertil Steril. 2008 Aug;90(2):378-84. Epub 2007 Oct 22.

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412