HSD17B6

Gene Information
 
Gene Symbol
HSD17B6
 
Aliases
HSE, RODH, SDR9C6
 
Entrez Gene ID
 
Gene Name
Hydroxysteroid (17-beta) dehydrogenase 6
 
Chromosomal Location
12q13
 
HGNC ID
 
Summary
The protein encoded by this gene has both oxidoreductase and epimerase activities and is involved in androgen catabolism. The oxidoreductase activity can convert 3 alpha-adiol to dihydrotestosterone, while the epimerase activity can convert androsterone to epi-androsterone. Both reactions use NAD+ as the preferred cofactor. This gene is a member of the retinol dehydrogenase family. (provided by RefSeq, Aug 2013)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs898611 GGGGCACAGAGAGAGTCTGGACACGT
-/G
GGGGAGTCAGCCGTGTATCATCGGA Intron variant 21039282, 17070195

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006702 Biological process Androgen biosynthetic process NAS 9188497
GO:0006710 Biological process Androgen catabolic process TAS 9188497
GO:0005622 Cellular component Intracellular NAS 11513953
GO:0003824 Molecular function Catalytic activity TAS 9188497
GO:0009055 Molecular function Electron carrier activity TAS 9188497
Protein Information
 
Protein Name
17-beta-HSD 6, 3(alpha->beta)-hydroxysteroid epimerase, 3(alpha->beta)-hydroxysteroid epimerasel, 3-alpha->beta-HSE, 3-alpha->beta-hydroxysteroid epimerase, 3-hydroxysteroid epimerase, NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase 3-hydroxysteroid epimerase, hydroxysteroid (17-beta) dehydrogenase 6 homolog, oxidative 3-alpha hydroxysteroid dehydrogenase, oxidative 3-alpha-hydroxysteroid-dehydrogenase, oxidoreductase, retinol dehydrogenase, short chain dehydrogenase/reductase family 9C member 6, short chain dehydrogenase/reductase family 9C, member 6
 
Function
NAD-dependent oxidoreductase with broad substrate specificity that shows both oxidative and reductive activity (in vitro). Has 17-beta-hydroxysteroid dehydrogenase activity towards various steroids (in vitro). Converts 5-alpha-androstan-3-alpha,17-beta-diol to androsterone and estradiol to estrone (in vitro). Has 3-alpha-hydroxysteroid dehydrogenase activity towards androsterone (in vitro). Has retinol dehydrogenase activity towards all-trans-retinol (in vitro). Can convert androsterone to epi-androsterone. Androsterone is first oxidized to 5-alpha-androstane-3,17-dione and then reduced to epi-andosterone. Can act on both C-19 and C-21 3-alpha-hydroxysteroids
 
Refseq Proteins
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00106 adh_short
 
KEGG
 
OMIM

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 19837928
   
References
 
Primary:

Association analysis between the polymorphisms of HSD17B5 and HSD17B6 and risk of polycystic ovary syndrome in Chinese population.

Ju Rong, Wu Wei, Fei Juan, Qin Yufeng, Tang Qiuqin, Wu Di, Xia Yankai, Wu Jie, Wang Xinru
Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Med| Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Med| Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China.| Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China.| Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China.| Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China.| Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China.| Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China xrwang@njmu.edu.cn jie.wuyale@gmail.com.| Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China Department of Gynaecology and ObstetricsNanjing Jiangning Hospital Affiliated to Nanjing Medical University, Nanjing 211100, ChinaState Key Laboratory of Reproductive MedicineSchool of Public Health, Institute of Toxicology, Nanjing Medical University, 101 Longmian Road, Nanjing 211166, ChinaKey Laboratory of Modern ToxicologyNanjing Medical University, Ministry of Education, Nanjing 211166, ChinaState Key Laboratory of Reproductive MedicineWuxi Maternal and Child Health Hospital Affiliated to Nanjing Medical University, Wuxi 214002, ChinaJiangsu Provincial Center for Disease Control and PreventionNanjing 210009, ChinaState Key Laboratory of Reproductive MedicineNanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, ChinaState Key Laboratory of Reproductive MedicineDepartment of Gynaecology, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing 210029, China xrwang@njmu.edu.cn jie.wuyale@gmail.com.
Eur J Endocrinol. 2015 Mar;172(3):227-33. doi: 10.1530/EJE-14-0615. Epub 2014 Nov
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
Insulin 
PCOS 
rs898611, rs10459247, rs10876920,  
NIH criteria 
Related 
335 White women with PCOS and 198 White controls 
Although we did not replicate association between PCOS and rs898611, we replicated associations of this variant and others in HSD17B6 with metabolic traits. These replication data suggest a role for HSD17B6 in PCOS. How HSD17B6, an enzyme involved in steroid metabolism, may influence BMI and insulin resistance in PCOS remains to be determined. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
25130462
Testosterone treatment increases androgen receptor and aromatase gene expression in myotubes from patients with PCOS and controls, but does not induce insulin resistance. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412