HSD11B1

Gene Information
 
Gene Symbol
HSD11B1
 
Aliases
11-DH, 11-beta-HSD1, CORTRD2, HDL, HSD11, HSD11B, HSD11L, SDR26C1
 
Entrez Gene ID
 
Gene Name
Hydroxysteroid (11-beta) dehydrogenase 1
 
Chromosomal Location
1q32-q41
 
HGNC ID
 
Summary
The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs12086634 AGAATGGGAAAGGTATCAACCCCAGA
G/T
GATTTCTTAATATAGCCATCTCTTG Intron variant 16551740

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0008202 Biological process Steroid metabolic process EXP 15583024
GO:0005789 Cellular component Endoplasmic reticulum membrane EXP 1885595
GO:0003845 Molecular function 11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity EXP 1885595
Protein Information
 
Protein Name
Corticosteroid 11-beta-dehydrogenase isozyme 1
 
Function
Catalyzes reversibly the conversion of cortisol to the inactive metabolite cortisone. Catalyzes reversibly the conversion of 7-ketocholesterol to 7-beta-hydroxycholesterol. In intact cells, the reaction runs only in one direction, from 7-ketocholesterol to 7-beta-hydroxycholesterol (By similarity)
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00106 adh_short short chain dehydrogenase
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions
STRING MINT I2D
ENSP00000261465 P28845

Associated Diseases

Diseases References
Acth deficiency 10770221
Anovulation 23678035
Cancer (adenoma) 12574226, 11956655
Cardiovascular diseases 18775471, 17712112, 17017977
Cushing syndrome 16914598, 17766714, 18209879
   
References
 
Primary:

Expression of 11beta-hydroxysteroid dehydrogenase 1 and 2 in subcutaneous adipose tissue of lean and obese women with and without polycystic ovary syndrome.

Svendsen P F, Madsbad S, Nilas L, Paulsen S K, Pedersen S B
Department of Obstetrics and Gynaecology, Copenhagen University Hospital, Hvidovre, Denmark. pernille.svendsen@hvh.regionh.dk
Int J Obes (Lond). 2009 Nov;33(11):1249-56. Epub 2009 Aug 25.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
PCOS 
T-->G in the third intron rs12086634 
Rotterdam criteria 
Related 
102 Caucasian PCOS, 98 controls 
Genetic variation in 11beta-HSD1 contributes to enhanced cortisol clearance and compensatory adrenal hyperandrogenism in lean patients with PCOS but may be protective against obesity and some features of the metabolic syndrome 
 
PCOS, anovulation 
 
 
Related 
37 PCOS , 14 normal 
There is decreased inactivation of cortisol in follicles from anovulatory PCOS. This may reflect inhibition of 11HSD1 by androgens and their 7/11-oxy-metabolites, local concentrations of which are increased in PCOS, and may contribute to the block to folliculogenesis seen in PCOS. 
CYP17A1 
 
 
NIH criteria 
Related 
28 Caucasian PCOS women and 187 Caucasian controls 
 
H6PDH, GR 
PCOS 
 
 
Related 
16 women with PCOS and 18 controls  
Expression of 11 -HSD1 mRNA was increased in the SAT from the women with PCOS, which may contribute to the increased local active glucocorticoids (cortisol), and subsequently affects the secretion of the local adipose tissue 
 
obesity,PCOS 
rs846910, rs12086634 
 
Related 
20 Caucasian women with PCOS, 20 Caucasian controls 
Tissue-specific dysregulation of HSD11B1 is a feature of PCOS 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
23132696, PMC3547489
Novel H6PDH mutations in two girls with premature adrenarche: 'apparent' and 'true' CRD can be differentiated by urinary steroid profiling. 
Clinical study 
21622477
A combination of polymorphisms in HSD11B1 associates with in vivo 11{beta}-HSD1 activity and metabolic syndrome in women with and without polycystic ovary syndrome. 
Clinical study 
21147223
Expression of 11??-hydroxysteroid dehydrogenase type 1 in visceral and subcutaneous adipose tissues of patients with polycystic ovary syndrome is associated with adiposity. 
Clinical study 
21117953
Optimization of high-resolution melting analysis for simultaneous genotyping of two 11??-hydroxysteroid dehydrogenase type 1 gene polymorphisms. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412