H6PD

Gene Information
 
Gene Symbol
H6PD
 
Aliases
CORTRD1, G6PDH, GDH
 
Entrez Gene ID
 
Gene Name
Hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
 
Chromosomal Location
1p36
 
HGNC ID
 
Summary
There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs6688832 CGATTACTACGCCTACAGCCCTGTGC
A/G
GGAGCGGGACGCCCACTCCGTCCTC R453Q 22306327
rs34603401 CGATTACTACGCCTACAGCCCTGTGC
A/G
GGAGCGGGACGCCCACTCCGTCCTC D151A 22306327
Protein Information
 
Protein Name
6-phosphogluconolactonase
 
Function
Oxidizes glucose-6-phosphate and glucose, as well as other hexose-6-phosphates
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00479 G6PD_N Glucose-6-phosphate dehydrogenase, NAD binding domain
PF01182 Glucosamine_iso Glucosamine-6-phosphate isomerases/6-phosphogluconolactonase
PF02781 G6PD_C Glucose-6-phosphate dehydrogenase, C-terminal domain
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions
STRING MINT I2D
ENSP00000366620

Associated Diseases

Diseases References
Diabetes mellitus insulin-dependent 10900297
Hemolysis 1715192, 14751857
Hyperandrogenism 21050867
Obesity 18622204
Pancreatitis 9670735
   
References
 
Primary:

A study of the hexose-6-phosphate dehydrogenase gene R453Q and 11beta-hydroxysteroid dehydrogenase type 1 gene 83557insA polymorphisms in the polycystic ovary syndrome.

San Millan Jose L, Botella-Carretero Jose I, Alvarez-Blasco Francisco, Luque-Ramirez Manuel, Sancho Jose, Moghetti Paolo, Escobar-Morreale Hector F
Department of Endocrinology, Hospital Ramon y Cajal, Carretera de Colmenar Km 9'1, E-28034 Madrid, Spain.
J Clin Endocrinol Metab. 2005 Jul;90(7):4157-62. Epub 2005 Apr 12.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
HSD11B1 
CRD deficiency, PCOS 
H6PD R453Q variant and HSD11B1 83557insA 
NIH criteria 
Related 
116 PCOS and 76 controls 
The study found an association between H6PD R453Q variant and PCOS which might influence its phenotype by influencing adrenal activity 
 
 
R453Q (rs6688832) and D151A (rs34603401) variants in H6PD 
 
Related 
237 PCOS and 135 control  
the R453Q and D151A variants of the H6PD gene are associated with PCOS and obesity 
 
Hyperandrogenemia 
 
 
Related 
74 PCOS and 31controls 
H6PD gene is very polymorphic and missense variants are common, coding variants rarely (<1.5%) are responsible for hyperandrogenemic PCOS 
HSD11B1 
 
CRD-related variants in HSD11B1 (rs12086634) and H6PD (rs6688832) 
 
Related 
213 PCOS and 549 control 
variants in HSD11B1 and H6PD typed, though implicated in causation of CRD, do not influence susceptibility to PCOS 
HSD11B1 
CRD deficiency 
H6PD and HSD11B1 mutations 
 
Related 
 
CRD defines a new ER-specific redox potential and establishes H6PDH as a potential factor in the pathogenesis of PCOS 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
23132696, PMC3547489
Novel H6PDH mutations in two girls with premature adrenarche: 'apparent' and 'true' CRD can be differentiated by urinary steroid profiling. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412