GSK3B

Gene Information
 
Gene Symbol
GSK3B
 
Entrez Gene ID
 
Gene Name
Glycogen synthase kinase 3 beta
 
Chromosomal Location
3q13.3
 
HGNC ID
 
Summary
The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs6805251 ACTAATTAAACTAATAAAGTTCAAAT
A/C/G/T
ACTTTCTCAAGGTAGCATGTGCTGA 17270183
rs1719889 TATTCCTCTACCACTTGGCTAGATTA
A/T
GTGAGAATGGTAGCTTTGTAGGGAG Intron variant 17270183
rs1719895 ccaacacatgagctttgggggacata
C/T
tcaaatcatggcaCTGCTCTATTTA Intron variant 17270183
rs7624540 ctttggaaaatagtttggtaaccata
A/C
acttaccatatgatcagcaatttca Intron variant 17270183
rs2319398 attctatttatattaaatgtccagaa
G/T
agacagattgtggagacaaaaagat Intron variant 17270183

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0001837 Biological process Epithelial to mesenchymal transition IMP 15448698
GO:0001954 Biological process Positive regulation of cell-matrix adhesion IMP 18156211
GO:0005977 Biological process Glycogen metabolic process IDA 8638126
GO:0006468 Biological process Protein phosphorylation IDA 11035810
GO:0006983 Biological process ER overload response IDA 14744935
Protein Information
 
Protein Name
Glycogen synthase kinase-3 beta
 
Function
Participates in the Wnt signaling pathway. Implicated in the hormonal control of several regulatory proteins including glycogen synthase, MYB and the transcription factor JUN. Phosphorylates JUN at sites proximal to its DNA-binding domain, thereby reducing its affinity for DNA. Phosphorylates MUC1 in breast cancer cells, and decreases the interaction of MUC1 with CTNNB1/beta-catenin. Phosphorylates CTNNB1/beta-catenin. Phosphorylates SNAI1. Plays an important role in ERBB2-dependent stabilization of microtubules at the cell cortex. Prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. Phosphorylates MACF1 and this phosphorylation inhibits the binding of MACF1 to microtubules which is critical for its role in bulge stem cell migration and skin wound repair. May be required for early embryo development and neuron differentiation (By similarity)
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00069 Pkinase Protein kinase domain
 
KEGG
 
OMIM

Associated Diseases

Diseases References
Cancer (carcinoma) 19148484, 10549354
Dementia 16470248
Parkinson disease 16315267
Polycystic ovary syndrome (PCOS) 18768676
Senile plaques 18932008
   
References
 
Primary:

Preliminary evidence of glycogen synthase kinase 3 beta as a genetic determinant of polycystic ovary syndrome.

Goodarzi Mark O, Antoine Heath J, Pall Marita, Cui Jinrui, Guo Xiuqing, Azziz Ricardo
Department of Medicine, Division of Endocrinology, Diabetes and Metabolism, Cedars-Sinai Medical Center, Los Angeles, California 90048, USA.
Fertil Steril. 2007 Jun;87(6):1473-6. Epub 2007 Jan 30.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
AKT2 
 
rs3730051, rs8100018, rs11671439, rs2304188 
NIH criteria 
Related 
287 white women with PCOS, 187 white controls 
These data suggest that polymorphisms in two components of the insulin signaling pathway, AKT2 and GSK3B, are associated withPCOS. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
23349861, PMC3548783
Electrical vs manual acupuncture stimulation in a rat model of polycystic ovary syndrome: different effects on muscle and fat tissue insulin signaling. 
Animal study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412