GNRHR

Gene Information
 
Gene Symbol
GNRHR
 
Aliases
GNRHR1, GRHR, HH7, LHRHR, LRHR
 
Entrez Gene ID
 
Gene Name
Gonadotropin-releasing hormone receptor
 
Chromosomal Location
4q21.2
 
HGNC ID
 
Summary
This gene encodes the receptor for type 1 gonadotropin-releasing hormone. This receptor is a member of the seven-transmembrane, G-protein coupled receptor (GPCR) family. It is expressed on the surface of pituitary gonadotrope cells as well as lymphocytes, breast, ovary, and prostate. Following binding of gonadotropin-releasing hormone, the receptor associates with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Activation of the receptor ultimately causes the release of gonadotropic luteinizing hormone (LH) and follicle stimulating hormone (FSH). Defects in this gene are a cause of hypogonadotropic hypogonadism (HH). Alternative splicing results in multiple transcript variants encoding different isoforms. More than 18 transcription initiation sites in the 5' region and multiple polyA signals in the 3' region have been identified for this gene. [provided by RefSeq, Jul 2008]
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs1038426 GGGGCACAGAGAGAGTCTGGACACGT
-/G
GGGGAGTCAGCCGTGTATCATCGGA Utr variant 3 prime 21274726

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0007186 Biological process G-protein coupled receptor signaling pathway TAS 8386108
GO:0007275 Biological process Multicellular organismal development TAS 10686191
GO:0097211 Biological process Cellular response to gonadotropin-releasing hormone TAS 8386108
GO:0005887 Cellular component Integral component of plasma membrane TAS 8386108
GO:0016020 Cellular component Membrane TAS 9259321
Protein Information
 
Protein Name
Gonadotropin-releasing hormone receptor
 
Function
Receptor for gonadotropin releasing hormone (GnRH) that mediates the action of GnRH to stimulate the secretion of the gonadotropic hormones luteinizing hormone (LH) and follicle- stimulating hormone (FSH). This receptor mediates its action by association with G-proteins that activate a phosphatidylinositol- calcium second messenger system. Isoform 2 may act as an inhibitor of GnRH-R signaling.
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00001 7tm_1 7 transmembrane receptor (rhodopsin family)
 
KEGG
 
OMIM
 
Phenotype MIM ID

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 19403562, 21528473
   
References
 
Primary:

Common genetic variation in the 3'-untranslated region of gonadotropin-releasing hormone receptor regulates gene expression in cella and is associated with thyroid function, insulin secretion as well as insulin sensitivity in polycystic ovary syndrome patients.

Li Qiaoli, Yang Guizhong, Wang Ying, Zhang Xiaoping, Sang Qing, Wang Huan, Zhao Xinzhi, Xing Qinghe, He Lin, Wang Lei
Institute of Biomedical Science, Fudan University, No. 138 Yixueyuan Road, Shanghai, People's Republic of China.
Hum Genet. 2011 May;129(5):553-61. doi: 10.1007/s00439-011-0954-4. Epub 2011 Jan
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
Insulin sensitivity 
3'-UTR variant rs1038426 
 
Related 
 
In conclusion, our results strongly suggest that common genetic variant in GNRHR contributes to the phenotypic expression of PCOS. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
25157703, PMC4179628
Conditional knockout of the androgen receptor in gonadotropes reveals crucial roles for androgen in gonadotropin synthesis and surge in female mice. 
Animal study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412