FTO

Gene Information
 
Gene Symbol
FTO
 
Aliases
ALKBH9
 
Entrez Gene ID
 
Gene Name
Fat mass and obesity associated
 
Chromosomal Location
16q12.2
 
HGNC ID
 
Summary
This gene is a nuclear protein of the AlkB related non-haem iron and 2-oxoglutarate-dependent oxygenase superfamily but the exact physiological function of this gene is not known. Other non-heme iron enzymes function to reverse alkylated DNA and RNA damage by oxidative demethylation. Studies in mice and humans indicate a role in nervous and cardiovascular systems and a strong association with body mass index, obesity risk, and type 2 diabetes. (provided by RefSeq, Jul 2011)
 
GeneCards ID
 
UniGene
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs9939609 AGAAGACTTGGACTGGCCTCCAGGCA
G/T
CCCACAAGAGCCTCTGTGCCTGGTG Intron variant 26032905, 20092643, 20092643, 25498334, 19859840, 18478198
rs8050136 AGAAGACTTGGACTGGCCTCCAGGCA
G/T
CCCACAAGAGCCTCTGTGCCTGGTG Intron variant 25498334
rs9930506 AGAAGACTTGGACTGGCCTCCAGGCA
G/T
CCCACAAGAGCCTCTGTGCCTGGTG Intron variant 25498334
rs8057044 AGAAGACTTGGACTGGCCTCCAGGCA
G/T
CCCACAAGAGCCTCTGTGCCTGGTG Intron variant 25498334

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006307 Biological process DNA dealkylation involved in DNA repair IDA 18775698
GO:0035552 Biological process Oxidative single-stranded DNA demethylation IDA 18775698
GO:0035553 Biological process Oxidative single-stranded RNA demethylation IDA 18775698
GO:0042245 Biological process RNA repair IDA 18775698
GO:0070989 Biological process Oxidative demethylation IDA 18775698
Protein Information
 
Protein Name
Alpha-ketoglutarate-dependent dioxygenase FTO
 
Function
Dioxygenase that repairs alkylated DNA and RNA by oxidative demethylation. Has highest activity towards single-stranded RNA containing 3-methyluracil, followed by single-stranded DNA containing 3-methylthymine. Has low demethylase activity towards single-stranded DNA containing 1-methyladenine or 3-methylcytosine. Specifically demethylates N(6)-methyladenosine (m6A) RNA, the most prevalent internal modification of messenger RNA (mRNA) in higher eukaryotes. Has no activity towards 1-methylguanine. Has no detectable activity towards double-stranded DNA. Requires molecular oxygen, alpha-ketoglutarate and iron. Contributes to the regulation of the global metabolic rate, energy expenditure and energy homeostasis. Contributes to the regulation of body size and body fat accumulation
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
Accessions
IPR024366, IPR024367
 
Pfam
Pfam Accession Pfam ID
PF12933 FTO_NTD FTO catalytic domain
PF12934 FTO_CTD FTO C-terminal domain
 
OMIM
 
Phenotype MIM ID

Associated Diseases

Diseases References
Diabetes mellitus type 2 19913856
Hyperandrogenism 19913856
Obesity 19859840, 20092643, 18572014, 18478198, 19913856, 19625203, 23840863
Polycystic ovary syndrome (PCOS) 23840863
   
References
 
Primary:

Association of the common rs9939609 variant of FTO gene with polycystic ovary syndrome in Chinese women.

Yan Qun, Hong Jie, Gu Weiqiong, Zhang Yifei, Liu Qiaorui, Su Yuxia, Zhang Yuwen, Li Xiaoying, Cui Bin, Ning Guang
Shanghai Key Laboratory for Endocrine Tumors, Shanghai Institute of Endocrine and Metabolic Disease, Shanghai Clinical Center for Endocrine and Metabolic Diseases, Ruijin Hospital, Shanghai JiaoTong University School of Medicine, 197 RuiJin Er Lu, 200025 Shanghai, People's Republic of China.
Endocrine. 2009 Dec;36(3):377-82. doi: 10.1007/s12020-009-9257-0. Epub 2009 Oct
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
Obesity and type 2 diabetes mellitus 
FTO variant-rs9939609 
 
Related 
Chinese- 215 PCOS and 227 controls 
In conclusions, the rs9939609 variant in the FTO gene is associated with PCOS susceptibility in the Chinese population, probably because of its effect on BMI. 
 
Obesity,type 2 diabetes mellitus,hyperandrogenemia 
FTO variant-rs9939609 
 
Related 
 
The demonstrated that variants within the FTO gene influence hyperandrogenemia and anthropometric parameters in women with PCOS, indicating an important role of FTO variants not only in obesity and diabetes but also in hyperandrogenism in women with PCOS. 
 
Obesity 
FTO variant-rs9939609 
 
Related 
 
Variation in the FTO gene modifies weight, adiposity and other measures of obesity and insulin sensitivity in PCOS. 
 
Obesity and type 2 diabetes mellitus 
(SNP) rs1421085 (C/T) 
Rotterdam criteria 
Related 
European-207 PCOS and 100 controls 
 In logistic regression, this genotype strongly associated with MetS (P<0.0001, OR 3.2, 95% CI 1.8-5.7) and impaired fasting glucose (IFG) with P<0.0007, OR 7.7, 95% CI 2.1-28.6, independently of BMI or age, and to AUC(gluc) during OGTT (P<0.0001, alpha=0.99), indicating an influential role of the FTO gene in the glucose intolerance component of MetS. 
 
Obesity and type 2 diabetes mellitus 
FTO variant rs9939609 
 
Related 
UK British/Irish-463 PCOS and 1336 controls 
The predominant effect of FTO variants on PCOS susceptibility is probably mediated through adiposity. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26032905, PMC4455322
Interaction between common variants of FTO and MC4R is associated with risk of PCOS. 
Clinical study 
25592819
FTO gene variants are not associated with polycystic ovary syndrome in women from Southern Brazil. 
Clinical study 
25498334
Haplotyping strategy highlights the specificity of FTO gene association with polycystic ovary syndrome in Tunisian women population. 
Clinical study 
25215277, PMC4160584
FTO Gene Variants Are Associated with PCOS Susceptibility and Hyperandrogenemia in Young Korean Women. 
Clinical study 
25086788
Gene dose effect between a fat mass and obesity-associated polymorphism and body mass index was observed in Korean women with polycystic ovary syndrome but not in control women. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412