FST

Gene Information
 
Gene Symbol
FST
 
Aliases
FS
 
Entrez Gene ID
 
Gene Name
Follistatin
 
Chromosomal Location
5q11.2
 
HGNC ID
 
Summary
Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. The single FST gene encodes two isoforms, FST317 and FST344 containing 317 and 344 amino acids respectively, resulting from alternative splicing of the precursor mRNA. In a study in which 37 candidate genes were tested for linkage and association with polycystic ovary syndrome (PCOS) or hyperandrogenemia in 150 families, evidence was found for linkage between PCOS and follistatin. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs3797297 TCACGGTTATAAGTACCTATCTCATA
A/C
CTAGCAAGAAATATTTGCAAGTGAT Intron variant,upstream variant 2KB 17284512

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0000122 Biological process Negative regulation of transcription from RNA polymerase II promoter IDA 12702211
GO:0002244 Biological process Hemopoietic progenitor cell differentiation IDA 15451575
GO:0007165 Biological process Signal transduction NAS 12702211
GO:0032926 Biological process Negative regulation of activin receptor signaling pathway IDA 11948405
GO:0051798 Biological process Positive regulation of hair follicle development IDA 12514121
Protein Information
 
Protein Name
Follistatin
 
Function
Binds directly to activin and functions as an activin antagonist. Specific inhibitor of the biosynthesis and secretion of pituitary follicle stimulating hormone (FSH)
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00050 Kazal_1 Kazal-type serine protease inhibitor domain
PF09289 FOLN Follistatin/Osteonectin-like EGF domain
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions

Associated Diseases

Diseases References
Atherosclerosis 10077456, 9409206, 17449718
Azoospermia 9886507, 11275954
Cancer (carcinoma) 16740706, 17121532, 8636347, 8389547, 7514999, 9360531, 8636347, 11002947, 10081911, 11843063, 12203361
Endometriosis 17296189, 19549703
Infertility 14701941
   
References
 
Primary:

Increased follistatin levels after oral contraceptive treatment in obese and non-obese women with polycystic ovary syndrome.

Chen Mei-Jou, Yang Wei-Shiung, Chen Hsin-Fu, Kuo Jahn-Jahn, Ho Hong-Nerng, Yang Yu-Shih, Chen Shee-Uan
Department of Obstetrics and Gynecology, National Taiwan University Hospital, No 7 Chung-Shan South Road, 100 Taipei, Taiwan.
Hum Reprod. 2010 Mar;25(3):779-85. Epub 2010 Jan 20.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
inhibin and activin 
 
 
 
Related 
 
Insufficient production of inhibin alpha and possibly beta(A)-subunits,but not follistatin,is associated with follicular arrest in PCOS follicles 
 
 
 
 
Direct 
130 PCOS and 120 controls 
Methylation levels of CpG sites in theFST promoter and 5'-UTR are not associated with PCOS 
 
 
 
Rotterdam criteria 
Related 
Indian population (250 PCOS and 299 controls) 
Exonic variants of FST gene seems to be dependent on the subjects and its role in the PCOS pathophysiology cannot be established 
Androgen 
 
 
Rotterdam criteria 
Related 
239 PCOS and 38 control 
High myostatin level was associated with the increased risk of abdominal obesity after further adjusting the androgens and follistatin levels in women with PCOS 
hsCRP 
 
 
Rotterdam criteria 
Related 
Taiwanese population (155 PCOS and 37 controls) 
Follistatin and hsCRP levels in both the PCOS and control groups were significantly correlated with each other 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
23564759
Plasma follistatin is elevated in patients with type 2 diabetes: relationship to hyperglycemia, hyperinsulinemia, and systemic low-grade inflammation. 
Clinical study 
23550965
The role of epistasis in the etiology of Polycystic Ovary Syndrome among Indian women: SNP-SNP and SNP-environment interactions. 
Clinical study 
21918632, PMC3170008
SNP analysis of follistatin gene associated with polycystic ovarian syndrome. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412