FSHR

Gene Information
 
Gene Symbol
FSHR
 
Aliases
FSHR1O, LGR1, ODG1, FSHR
 
Entrez Gene ID
 
Gene Name
Follicle stimulating hormone receptor
 
Chromosomal Location
2p21-p16
 
HGNC ID
 
Summary
The protein encoded by this gene belongs to family 1 of G-protein coupled receptors. It is the receptor for follicle stimulating hormone and functions in gonad development. Mutations in this gene cause ovarian dysgenesis type 1, and also ovarian hyperstimulation syndrome. Alternative splicing results in multiple transcript variants. (provided by RefSeq, Mar 2010)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs6165 GGCAAGAAGTTGATTATATGACTCAG
A/G
CTAGGGGTCAGAGATCCTCTCTGGC A307T 19403562
rs6166 CTGCTCTTCAGCTCCCAGAGTCACCA
A/G
TGGTTCCACTTACATACTTGTCCCT N680S 19403562
rs11692782 GGACTGCAGGGCGCTCACGCTTGCTG
C/T
GAAGTAAGGCGTTTGAAGGTGAGGC Intron variant 25649397
rs2268361 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT Intron variant 25904635

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0007186 Biological process G-protein coupled receptor signaling pathway TAS 9020851
GO:0007283 Biological process Spermatogenesis TAS 9020851
GO:0007292 Biological process Female gamete generation TAS 9020851
GO:0008406 Biological process Gonad development TAS 9020851
GO:0008584 Biological process Male gonad development IEP 17848411
Protein Information
 
Protein Name
FSH receptor , follicle-stimulating hormone receptor , follicle stimulating hormone receptor, ODG1 , LGR1 , follitropin receptor , Follitropin receptor , FSH-R , FSHRO
 
Function
Receptor for follicle-stimulating hormone. The activity of this receptor is mediated by G proteins which activate adenylate cyclase
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00001 7tm_1 7 transmembrane receptor (rhodopsin family)
PF00560 LRR_1 Leucine Rich Repeat
PF01462 LRRNT Leucine rich repeat N-terminal domain
PF12369 GnHR_trans Gonadotropin hormone receptor transmembrane region
PF13855 LRR_8 Leucine rich repeat
 
KEGG
 
OMIM
 
Phenotype MIM ID

Associated Diseases

Diseases References
Anovulation 9141511
Azoospermia 17169197, 16730882, 20170288, 19550076, 9756276, 16338864, 17161332
Cancer (carcinoma) 12471615, 10620446, 19181441, 10914722, 8895668
Endometriosis 19342032
Epithelial tumor 12471615, 19181441, 10620446, 10914722, 17603635
   
References
 
Primary:

Genetic variations of follicle stimulating hormone receptor are associated with polycystic ovary syndrome.

Gu Bon-Hee, Park Jung-Mi, Baek Kwang-Hyun
Department of Biomedical Science, Fertility Center, CHA University, CHA General Hospital, Seoul 135-081, Korea.
Int J Mol Med. 2010 Jul;26(1):107-12.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
rs7562215, rs10495960, rs13405728, rs35960650, rs2956355, and rs7562879 
NIH criteria 
Direct 
905 women with PCOS, 956 control women  
Fine mapping of the chromosome 2p16.3 Chinese PCOS susceptibility locus in a European ancestry cohort provides evidence for association with two independent loci and PCOS. The gene products LHCGR and FSHR therefore are likely to be important in the etiology of PCOS, regardless of ethnicity 
LHCGR, THADA, DENND1A, c9orf3, YAP1, RAB5B/SUOX, HMGA2, TOX3, INSR, SUMO1P1 
 
rs2268361,rs2349415  
Rotterdam criteria 
Direct 
703 Dutch PCOS patients and 2164 Dutch controls 
This study identifies 12 genetic variants mapping to the Chinese PCOS loci similar effect size and identical direction in PCOS patients from Northern European ancestry, indicating a common genetic risk profile for PCOS across populations 
 
 
 
 
Direct 
47 European subjects with PCOS and 845 controls 
Four of the PCOS susceptibility loci identified in the Chinese GWAS are associated with PCOS in Europeans 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26273622, PMC4529894
Statistical Genomic Approach Identifies Association between FSHR Polymorphisms and Polycystic Ovary Morphology in Women with Polycystic Ovary Syndrome. 
Clinical study 
26220222, PMC4518258
Family-based analysis of eight susceptibility loci in polycystic ovary syndrome. 
Clinical study 
25904635, PMC4498224
Han Chinese polycystic ovary syndrome risk variants in women of European ancestry: relationship to FSH levels and glucose tolerance. 
Clinical study 
25837360
Association between two polymorphisms of follicle stimulating hormone receptor gene and susceptibility to polycystic ovary syndrome: a meta-analysis. 
Clinical study 
25721191
Follicle-stimulating hormone receptor polymorphism affects the outcome of ovulation induction in normogonadotropic (World Health Organization class 2) anovulatory subfertility. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412