FEM1B

Gene Information
 
Gene Symbol
FEM1B
 
Aliases
F1A-ALPHA, F1AA, FEM1-beta
 
Entrez Gene ID
 
Gene Name
Fem-1 homolog b (C. elegans)
 
Chromosomal Location
15q22
 
HGNC ID
 
Summary
This gene encodes an ankyrin repeat protein that belongs to the death receptor-associated family of proteins and plays a role in mediating apoptosis. The encoded protein is also thought to function in the replication stress-induced checkpoint signaling pathway via interaction with checkpoint kinase 1. (provided by RefSeq, Aug 2013)
 
GeneCards ID
 
UniGene
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs10152450 CGATTACTACGCCTACAGCCCTGTGC
A/G
GGAGCGGGACGCCCACTCCGTCCTC Intron variant,upstream variant 2KB 18757445

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006915 Biological process Apoptotic process NAS 10623617
GO:0051438 Biological process Regulation of ubiquitin-protein ligase activity IMP 15601820
GO:1902041 Biological process Regulation of extrinsic apoptotic signaling pathway via death domain receptors IMP 10542291
GO:2000001 Biological process Regulation of DNA damage checkpoint IMP 19330022
GO:0004842 Molecular function Ubiquitin-protein ligase activity IMP 15601820
Protein Information
 
Protein Name
Protein fem-1 homolog B
 
Function
Component of an E3 ubiquitin-protein ligase complex, in which it may act as a substrate recognition subunit. Involved in apoptosis by acting as a death receptor-associated protein that mediates apoptosis. Also involved in glucose homeostasis in pancreatic islet. Functions as an adapter/mediator in replication stress-induced signaling that leads to the activation of CHEK1
 
Refseq Proteins
 
UniProt
 
InterPro
Accessions
IPR002110, IPR020683
 
Pfam
Pfam Accession Pfam ID
PF00023 Ank Ankyrin repeat
 
OMIM

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 20200332
   
References
 
Primary:

FEM1A and FEM1B: novel candidate genes for polycystic ovary syndrome.

Goodarzi M O, Maher J F, Cui J, Guo X, Taylor K D, Azziz R
Department of Medicine, Division of Endocrinology, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA.
Hum Reprod. 2008 Dec;23(12):2842-9. doi: 10.1093/humrep/den324. Epub 2008 Aug 29.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
FEM1A,FEM1C 
Insulin-related traits 
FEM1B SNP rs10152450,FEM1B SNP rs12909277 
Elevation of circulating androgen levels, either testosterone (T) or nonsex hormone-binding globulin-bound testosterone (uT) associated with chronic oligomenorrhea (6 menses per year) or amenorrhea 
Related 
 
This study presents evidence suggesting a role for FEM1A and FEM1B in the pathogenesis of PCOS. 
FBN3,ACVR2A, POMC and SGTA 
 
 
Elevation of circulating androgen levels, either testosterone (T) or nonsex hormone-binding globulin-bound testosterone (uT) associated with chronic oligomenorrhea (6 menses per year) or amenorrhea 
Related 
 
A polymorphic variant, D19S884, in FBN3 is associated with risk of PCOS. POMC is also a candidate gene of interest. SGTA was found to be nominally significant 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412