FABP4

Gene Information
 
Gene Symbol
FABP4
 
Aliases
A-FABP, AFABP, ALBP, HEL-S-104, aP2
 
Entrez Gene ID
 
Gene Name
Fatty acid binding protein 4, adipocyte
 
Chromosomal Location
8q21.13
 
HGNC ID
 
Summary
FABP4 encodes the fatty acid binding protein found in adipocytes. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs3834363 cttcatcctctccatttacataaggc
A/G
tatggaattaaccaatggaatgctc Upstream variant 2KB 19844814

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0005737 Cellular component Cytoplasm TAS 16130169
GO:0005504 Molecular function Fatty acid binding TAS 2481498
GO:0005515 Molecular function Protein binding IPI 17353931
Protein Information
 
Protein Name
Fatty acid-binding protein, adipocyte
 
Function
Lipid transport protein in adipocytes. Binds both long chain fatty acids and retinoic acid. Delivers long-chain fatty acids and retinoic acid to their cognate receptors in the nucleus (By similarity)
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00061 Lipocalin Lipocalin / cytosolic fatty-acid binding protein family
 
KEGG
 
OMIM
 
Interactions

Associated Diseases

Diseases References
Atherosclerosis 17510463, 17396233, 15686734, 16423904
Cancer 15500004, 19115207
Cardiovascular diseases 16423904, 18419784, 17389279, 18849305
Inflammation 19475694, 17656598, 20156355, 19217286
Obesity 20156355, 19368945, 17656598, 19842034
   
References
 
Primary:

Expression and regulation of adipocyte fatty acid binding protein in granulosa cells and its relation with clinical characteristics of polycystic ovary syndrome.

Hu Weihong, Qiao Jie
Department of Gynecology and Obstetrics, Peking University Third Hospital, Beijing, 100083, China. weihong19@163.com
Endocrine. 2011 Oct;40(2):196-202. Epub 2011 Jun 22.

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
23529348
Utility of hemoglobin-A1C in nondiabetic women with polycystic ovary syndrome. 
Clinical study 
23480783
Free fatty acid binding protein-4 and retinol binding protein-4 in polycystic ovary syndrome: response to simvastatin and metformin therapies. 
Effect of treatment 
21720879
Expression and regulation of adipocyte fatty acid binding protein in granulosa cells and its relation with clinical characteristics of polycystic ovary syndrome. 
In vitro 
21605000
Fatty acid-binding protein-4 plasma levels are associated to metabolic abnormalities and response to therapy in girls and young women with androgen excess. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412