DENND1A

Gene Information
 
Gene Symbol
DENND1A
 
Aliases
FAM31A, KIAA1608
 
Entrez Gene ID
 
Gene Name
DENN/MADD domain containing 1A
 
Chromosomal Location
9q34.11
 
HGNC ID
 
Summary
Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1A, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 (PubMed 20154091)).(supplied by OMIM, Nov 2010)
 
GeneCards ID
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs10818854 ATTCCTGCTGGTCTTGGTTAGTACCA
C/T
TCAATAAAATGTTAGGACCCGGGCT Intron variant 25586784, 22547425
rs2479106 TGCTGTGCAAAGTTAGAAGATGAAAC
A/C
AAACTGATTACATACACCTATACCC Intron variant 23208300, 22009367
rs10986105 ATTCCTGCTGGTCTTGGTTAGTACCA
C/T
TCAATAAAATGTTAGGACCCGGGCT Intron variant 22547425
rs2479106 TGCTGTGCAAAGTTAGAAGATGAAAC
A/C
AAACTGATTACATACACCTATACCC Intron variant 21151128
Protein Information
 
Protein Name
KIAA1608 , connecdenn 1 , RP11-230L22.3 , DENN/MADD domain containing 1A, FAM31A , Connecdenn , Connecdenn 1 , Protein FAM31A , DENN domain-containing protein 1A , FLJ21129
 
Function
Guanine nucleotide exchange factor (GEF) regulating clathrin-mediated endocytosis through RAB35 activation. Promotes the exchange of GDP to GTP, converting inactive GDP-bound RAB35 into its active GTP-bound form. Regulates clathrin-mediated endocytosis of synaptic vesicles
 
Refseq Proteins
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF02141 DENN DENN (AEX-3) domain
PF03455 dDENN dDENN domain
PF03456 uDENN uDENN domain
 
OMIM

Associated Diseases

Diseases References
Endometrioid adenocarcinoma 22902918
Hyperandrogenism 22547425, 22180642
Menstrual irregularities 22547425, 22180642
Polycystic ovary syndrome (PCOS) 22504079, 25303487, 22009367, 24106282, 23208300
   
References
 
Primary:

Variants in DENND1A are associated with polycystic ovary syndrome in women of European ancestry.

Welt Corrine K, Styrkarsdottir Unnur, Ehrmann David A, Thorleifsson Gudmar, Arason Gudmundur, Gudmundsson Jens A, Ober Carole, Rosenfield Robert L, Saxena Richa, Thorsteinsdottir Unnur, Crowley William F, Stefansson Kari
Reproductive Endocrine Unit, Massachusetts General Hospital, 55 Fruit Street, Boston, Massachusetts 02114, USA. cwelt@partners.org
J Clin Endocrinol Metab. 2012 Jul;97(7):E1342-7. doi: 10.1210/jc.2011-3478. Epub
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
Hyperandrogenism and irregular menses 
Pcos risk variants-rs10986105[C] and rs10818854[A] 
Rotterdam criteria 
Related 
PCOS-376 Icelandic,565 from Boston, MA and 203 from Chicago, IL and 6,947, 483, and 189 controls from Iceland, Boston, and Chicago respectively 
The same allele of rs10986105 that increased the risk of PCOS also increased the risk of hyperandrogenism in women without PCOS from Iceland and demonstrated a stronger risk for PCOS defined by the National Institutes of Health criteria than the Rotterdam criteria. 
LHCGR 
 
SNP rs2479106 in gene DENND1A 
 
Direct 
Denmark-268 patients with PCOS between 1997 and 2011 and 248 controls 
The rs2479106 G (DENND1A gene) allele was associated with a decreased PCOS susceptibility. 
THADA 
Hyperandrogenism and irregular menses 
Variation in the gene  
NICHD criteria 
Direct 
European derived PCOS cohorts-(cohort A = 939 cases and 957 controls) and (cohort B = 535 cases and 845 controls) 
At least two of the PCOS susceptibility loci identified in the Chinese PCOS GWAS (DENND1A and THADA) are also associated with PCOS in European derived populations, and are therefore likely to be important in the aetiology of PCOS regardless of ethnicity. 
 
 
 
Rotterdam criteria 
Related 
1731 Hans Chinese PCOS patients, 4964 Hans Chinese controls 
The PCOS susceptibility genes, THADA and DENND1A, carry risk alleles that are associated with endocrine and metabolic disturbances in PCOS patients of Han Chinese descent 
 
PCOS 
rs2479106 
 
Related 
545 Caucasian PCOS and 317 control women 
The study found an association of the rs2479106 variant with PCOS susceptibility 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
25978310, PMC4433204
Association Study between Polycystic Ovarian Syndrome and the Susceptibility Genes Polymorphisms in Hui Chinese Women. 
Clinical study 
25904635, PMC4498224
Han Chinese polycystic ovary syndrome risk variants in women of European ancestry: relationship to FSH levels and glucose tolerance. 
Clinical study 
25626177
DENND1A gene variants in Bahraini Arab women with polycystic ovary syndrome. 
Clinical study 
25586784
Polycystic ovary syndrome susceptibility single nucleotide polymorphisms in women with a single PCOS clinical feature. 
Clinical study 
25169637
[Correlation analysis between polycystic ovary syndrome susceptibility genes and metabolic phenotypes]. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412