CYP1A1

Gene Information
 
Gene Symbol
CYP1A1
 
Aliases
AHH, AHRR, CP11, CYP1, P1-450, P450-C, P450DX
 
Entrez Gene ID
 
Gene Name
Cytochrome P450, family 1, subfamily A, polypeptide 1
 
Chromosomal Location
15q24.1
 
HGNC ID
 
Summary
This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. (provided by RefSeq, Jul 2008)
 
GeneCards ID
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
MspI
Microsatellite 23852617
rs4646903 GGACTGCAGGGCGCTCACGCTTGCTG
C/T
GAAGTAAGGCGTTTGAAGGTGAGGC Downstream variant 500B 23848208
rs1048943 GGACTGCAGGGCGCTCACGCTTGCTG
C/T
GAAGTAAGGCGTTTGAAGGTGAGGC I462F 23848208

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0017144 Biological process Drug metabolic process IDA 19219744
GO:0042359 Biological process Vitamin D metabolic process IC 15546903
GO:0055114 Biological process Oxidation-reduction process IDA 19219744
GO:0016491 Molecular function Oxidoreductase activity IDA 19219744
GO:0019825 Molecular function Oxygen binding TAS 1691986
Protein Information
 
Protein Name
Cytochrome P450 1A1
 
Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00067 p450 Cytochrome P450
 
KEGG
 
OMIM

Associated Diseases

Diseases References
Cancer (carcinoma) 9139841, 11953897, 12144816, 19160101, 10575002, 10496959, 10078108, 12417264, 9054634
Cardiovascular diseases 15805301
Endometriosis 12903034, 15861041, 12620480, 18849443, 10764452, 16527884, 12760253, 11730751, 11452142, 11393538, 11675474
Hyperandrogenism 11117678
Infertility 18774560
   
References
 
Primary:

CYP1A1 polymorphism in adolescents with polycystic ovary syndrome.

Akgul Sinem, Derman Orhan, Alikasifoglu Mehmet, Aktas Dilek
Department of Pediatrics, Division of Adolescent Medicine, Hacettepe University Faculty of Medicine, Ankara, Turkey. sinemhusnu@yahoo.com
Int J Gynaecol Obstet. 2011 Jan;112(1):8-10. Epub 2010 Oct 20.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
GSTM1, GSTT1 
 
CYP1A1 (T6235C), GSTM1[-] and GSTT1[-] 
 
Related 
252 (180 PCO, 72 controls) 
The study concludes that the presence of hyperinducible CYP1A1 (T6235C) mutant genotype and its mutants in combination with GSTM1 and GSTT1 null genotypes might cause an imbalance between phase I and phase II enzymes, and therefore may represent a risk factor for PCO 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
23852617
Common polymorphisms in the CYP1A1 and CYP11A1 genes and polycystic ovary syndrome risk: a meta-analysis and meta-regression. 
Meta analysis 
23848208
CYP1A1 gene polymorphisms and polycystic ovary syndrome risk: a meta-analysis and meta-regression. 
Meta analysis 
20965504
CYP1A1 polymorphism in adolescents with polycystic ovary syndrome. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412