CYP19A1

Gene Information
 
Gene Symbol
CYP19A1
 
Aliases
ARO, ARO1, CPV1, CYAR, CYP19, CYPXIX, P-450AROM
 
Entrez Gene ID
 
Gene Name
Cytochrome P450, family 19, subfamily A, polypeptide 1
 
Chromosomal Location
15q21
 
HGNC ID
 
Summary
This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and catalyzes the last steps of estrogen biosynthesis, three successive hydroxylations of the A ring of androgens. Mutations in this gene can result in either increased or decreased aromatase activity; the associated phenotypes suggest that estrogen functions both as a sex steroid hormone and in growth or differentiation. The gene expresses two transcript variants. (provided by RefSeq)
 
GeneCards ID
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs700519 TAGAAGTTCTGATAGCAGAAAAAAGA
C/T
GCAGGATTTCCACAGAAGAGAAACT R264C 21282199
rs710059 TAGAAGTTCTGATAGCAGAAAAAAGA
C/T
GCAGGATTTCCACAGAAGAGAAACT Intron variant 21282199

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006694 Biological process Steroid biosynthetic process TAS 2848247
GO:0006703 Biological process Estrogen biosynthetic process EXP 15583024
GO:0008202 Biological process Steroid metabolic process EXP 15583024
GO:0005624 Cellular component Membrane fraction TAS 2848247
GO:0005783 Cellular component Endoplasmic reticulum IDA 11256614
Protein Information
 
Protein Name
Aromatase
 
Function
Catalyzes the formation of aromatic C18 estrogens from C19 androgens
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00067 p450 Cytochrome P450
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions

Associated Diseases

Diseases References
Antley-bixler syndrome 15483095
Bone loss 18515009, 19709826, 16844441, 18068489, 16100521, 12759877, 18486346, 19125005, 12017550, 16357189, 15719598, 18453874, 18829518, 19073509, 16730272, 19152547, 17618847, 16986348, 15807925, 15794932, 20398352, 19655244, 18231646, 16978789, 16800971, 15477866, 10843162, 20079640, 19853678, 19364653, 18023583, 17150002, 15983395, 18955443, 18614276, 18379033, 18465344, 16989586, 16224233, 19708541, 19218306, 19122265, 18282367, 17904790, 15579733, 12548590, 19433387, 18430387, 17643293, 17621865, 16809162, 14517714, 15585380, 19898774, 18955450, 18725648, 17010062, 19803932, 17267326
Cancer (carcinoma) 8371007, 19531212, 19883428, 9010322, 17440110, 18622573, 9797021, 17624762, 2257241, 2340513, 9365204, 8686761, 8603447, 8200649, 8768875, 8932332, 15456920, 14508827, 12794759, 20157776, 19956630, 14643970, 11398169, 7853554, 8154854, 11516810, 10845274, 9140125, 15907334, 10917548, 8923858, 18157729, 18480557, 19782135, 9831487, 9365197, 9883986
Endocrine disorder 9365182
Endometriosis 8550748, 20430665, 18048499, 10593363, 17687621, 11045871, 17012104, 18335325, 15083380, 15743158, 18485158, 19496625, 11994385, 16359564, 16641167, 10652502, 9548162, 16123052, 10731122, 9024261, 11925378, 18930188, 17678915, 18089598, 17112691, 16109840, 18056119, 14968065, 19233536, 1940542, 12620480, 16024248, 16566930, 16806212, 16157442, 17336977, 12650711, 19001523, 10559661, 19493871, 19340622, 18848966, 15760962, 15782073, 11949967, 16595205, 16285913, 16274608, 14505258, 11516810, 18555228, 15136110, 19150483, 18165439, 19804039, 19137777, 16647373, 11850203, 15640252, 10915216, 11235156, 15523811, 9365182, 12917782, 19261371, 15237030, 14967362, 12517244, 19608462, 14631363, 17540816, 12957661, 9851796, 8550788, 19097589, 17550490, 16084868, 14723761, 12475548, 18402947, 17484506, 16084890, 12810542, 18559914, 17921479, 12598839, 12372439, 11502834, 9282984, 20227163, 20430669, 18973892, 18711959, 17454161, 19388539, 16564227, 14649213, 12161505, 19726448
   
References
 
Primary:

CYP19 gene: a genetic modifier of polycystic ovary syndrome phenotype.

Xita Nectaria, Lazaros Leandros, Georgiou Ioannis, Tsatsoulis Agathocles
Department of Endocrinology, University of Ioannina, Ioannina, Greece.
Fertil Steril. 2010 Jun;94(1):250-4. Epub 2009 Mar 26.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
variation in gene 
 
Related 
132 women with PCOS and 200 with male-factor infertility, as controls 
Potential associations of the CYP19(TTTA)7 allele with ovarian response to standard gonadotrophin stimulation and with assisted reproduction outcome were found in PCOS women, probably due to androgen/estrogen ratio alterations. 
 
 
 
 
Related 
661 individuals [364 polycystic ovary syndrome (PCOS) patients and 297 controls]  
The rs2470152 in CYP19 was not a major etiological factor for PCOS; however, the heterozygous TC genotype may inhibit aromatase activity, resulting in hyperandrogenism, particularly in PCOS patients. 
 
Androgen excess and hyperinsulinemia 
 
 
Related 
31 PCOS patients and 27 BMI-matched women with regular cycles 
CYP19 gene expression in subcutaneous fat of PCOS patient correlated positively with systolic (p = 0.006) and diastolic blood pressure (p = 0.009). Androgen excess and hyperinsulinemia may play a role in the molecular mechanisms that activate aromatase mRNA transcription in abdominal fat tissue. 
 
 
 
 
Related 
123 patients with PCOS and 113 healthy controls 
The most common allele of the tetranucleotide TTTA repeat polymorphism in the forth intron of CYP19 gene in Han Chinese women is 11R, which was different with the previous study in European Caucasians. 
 
 
SNP rs2414096 
Rotterdam criteria 
Related 
684 individuals (386 PCOS patients and 298 controls) 
SNP rs2414096 in the CYP19 gene is associated with susceptibility to PCOS 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26282993, PMC4539686
MicroRNA-132 promotes estradiol synthesis in ovarian granulosa cells via translational repression of Nurr1. 
In vitro 
25887459, PMC4414284
Polycystic ovarian syndrome is accompanied by repression of gene signatures associated with biosynthesis and metabolism of steroids, cholesterol and lipids. 
Clinical study 
25211419
Immunohistochemical evaluation of proliferation, apoptosis and steroidogenic enzymes in the ovary of rats with polycystic ovary. 
Animal study 
25130462
Testosterone treatment increases androgen receptor and aromatase gene expression in myotubes from patients with PCOS and controls, but does not induce insulin resistance. 
Clinical study 
25061847, PMC4138569
Developmental programming: prenatal steroid excess disrupts key members of intraovarian steroidogenic pathway in sheep. 
Animal study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412