CYP11A1

Gene Information
 
Gene Symbol
CYP11A1
 
Aliases
CYP11A, CYPXIA1, P450SCC
 
Entrez Gene ID
 
Gene Name
Cytochrome P450, family 11, subfamily A, polypeptide 1
 
Chromosomal Location
15q23-q24
 
HGNC ID
 
Summary
This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. (provided by RefSeq)
 
GeneCards ID
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs4077582 aaaaaaaaaaaaaaaaaaaGCAGGGG
C/G
CGGGGACAGGGCAGGAGCCCATTCC 20450755, 22699877
D15S1546
Microsatellite 20450755
D15S1547
Microsatellite 20450755
rs11632698 GAGGGCCAGGAACTGATATTCTTAGA
A/G
CCCTTTGTGTAACTTTCAGTCTCTC Intron variant 20450755
rs4887139 ACTGACCGCCTCCCCAGAAGTGGCCC
A/G
GGCTGGAGGTTATTGCCTCATCCTC Upstream variant 2KB 20450755

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0008202 Biological process Steroid metabolic process EXP 15583024
Protein Information
 
Protein Name
Cholesterol side-chain cleavage enzyme, mitochondrial
 
Function
Catalyzes the side-chain cleavage reaction of cholesterol to pregnenolone
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00067 p450 Cytochrome P450
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions

Associated Diseases

Diseases References
Aldosteronism primary 1820978
Autoimmunity 8626850, 11751076
Cancer (carcinoma) 8200649, 15819722, 11869873, 9231058, 10372718, 1309352, 7678794, 16730372
Endocrine disorder 8167572, 15159300
Hyperandrogenism 18406240, 10419001, 19570444, 20450755, 21557918, 18499961
   
References
 
Primary:
PMID: 9455828

The genetic basis of polycystic ovary syndrome.

Franks S, Gharani N, Waterworth D, Batty S, White D, Williamson R, McCarthy M
Department of Obstetrics and Gynaecology, Imperial College School of Medicine, St Mary's Hospital, London, UK.
Hum Reprod. 1997 Dec;12(12):2641-8.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
CYP17  
hyperandrogenic  
A2/A2 genotype 
 
Related 
65 patients and 58 age matched healthy controls 
The results suggest that both alleles play a minor role in the development of PCOS and could be a genetic risk marker of the hyperandrogenic phenotype. 
CYP17,androstenedione,17alpha-hydroxyprogesterone, and DHEAS 
 
Polymorphism in CYP11A1 promoter 
Rotterdam criteria 
Related 
India-100 PCOS and 100 controls 
The study carried out in a defined group of Indian women with PCOS suggests for the first time an individual, as well as combined, association of polymorphisms in CYP11A1 and CYP17 promoters with T levels. 
 
 
SNP rs4077582 
 
Related 
314 PCOS patients and 314 controls 
SNP rs4077582 in CYP11A1 is strongly associated with susceptibility to PCOS and may alter the testosterone levels by the regulation of LH in different genotypes. No association was observed in rs11632698. 
 
 
 
 
Related 
290 PCOS and 344 controls 
The polymorphism of CYP11A1 gene was associated with PCOS, however, the relationship between gene sequence covered by tSNP/microsatellite markers and hyperandrogenism of PCOS should be further investigated. 
 
 
 
 
Related 
256 PCOS and 109 healthy control women 
Despite of some associations found, it seems that the promoter variability of CYP11A1 does not play a key role in the pathogenesis of PCOS. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26357661, PMC4556819
Paracrine Regulation of Steroidogenesis in Theca Cells by Granulosa Cells Derived from Mouse Preantral Follicles. 
Animal study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412