CASR

Gene Information
 
Gene Symbol
CASR
 
Aliases
CAR, EIG8, FHH, FIH, GPRC2A, HHC, HHC1, HYPOC1, NSHPT, PCAR1
 
Entrez Gene ID
846
 
Gene Name
Calcium-sensing receptor
 
Chromosomal Location
3q21.1
 
HGNC ID
 
Summary
The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs1801725 TGAGCTTTGATGAGCCTCAGAAGAAC
G/T
CCATGGCCCACAGGAATTCTACGCA A986S 21082232

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0001503 Biological process Ossification TAS 7874174
GO:0006874 Biological process Cellular calcium ion homeostasis TAS 7874174
GO:0007186 Biological process G-protein coupled receptor protein signaling pathway TAS 7759551
GO:0007635 Biological process Chemosensory behavior TAS 7759551
GO:0009653 Biological process Anatomical structure morphogenesis TAS 7916660
Protein Information
 
Protein Name
Extracellular calcium-sensing receptor
 
Function
Senses changes in the extracellular concentration of calcium ions. The activity of this receptor is mediated by a G-protein that activates a phosphatidylinositol-calcium second messenger system
 
Refseq Proteins
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00003 7tm_3 7 transmembrane sweet-taste receptor of 3 GCPR
PF01094 ANF_receptor Receptor family ligand binding region
PF07562 NCD3G Nine Cysteines Domain of family 3 GPCR
 
OMIM
 
Phenotype MIM ID
 
Interactions
STRING MINT I2D
ENSP00000296154 P41180

Associated Diseases

Diseases References
Apeced 17660615, 14764761
Atherosclerosis 15761385, 19355938
Autoimmune diseases 15356052, 8810727, 18981636, 17374709
Autoimmunity 17660615, 14713274
Bartters syndrome 12241879, 17048213, 15200151, 18328986
   
References
 
Primary:

Influence of gene variants related to calcium homeostasis on biochemical parameters of women with polycystic ovary syndrome.

Ranjzad Fariba, Mahban Aidin, Shemirani Atena Irani, Mahmoudi Touraj, Vahedi Mohsen, Nikzamir Abdolrahim, Zali Mohammad Reza
Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, 1417613151, Tehran, Iran.
J Assist Reprod Genet. 2011 Mar;28(3):225-32. Epub 2010 Nov 17.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
VDR 
 
 
NICHD criteria 
Related 
56 Iranian PCOS women 
This data indicated for the first time that it is possible that the VDR and CASR gene variants through their effects on LH and SHBG levels, and insulin resistance are involved in pathogenesis of PCOS 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412