CAPN10

Gene Information
 
Gene Symbol
CAPN10
 
Aliases
CANP10, NIDDM1
 
Entrez Gene ID
 
Gene Name
Calpain 10
 
Chromosomal Location
2q37.3
 
HGNC ID
 
Summary
Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs3792267 CGCTCACGCTTGCTGTGAAGTAAGGC
A/G
TTTGAAGGTGAGGCTAAGCCTTGAC Intron variant 24993116
rs3842570 GAGGGTGATGATTCTGTCCCAGGAGC
-/CGGGAGGAGGGTGATGATTCTGTCCCAGGAGC
TGGGAGGAGGGTGGGCTTGTGGGAG Intron variant 24993116
rs5030952 GGGGCCAGGGCCTGACGGGGGTGGAG
C/T
GAGGGGTGGGCCGCGTCTGTGCAGG 24993116
rs2975760 GGACTGCAGGGCGCTCACGCTTGCTG
C/T
GAAGTAAGGCGTTTGAAGGTGAGGC Intron variant 22384174

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006508 Biological process Proteolysis IMP 15044459
GO:0031532 Biological process Actin cytoskeleton reorganization ISS 12974673
GO:0032024 Biological process Positive regulation of insulin secretion IMP 15471947
GO:0032388 Biological process Positive regulation of intracellular transport ISS 12974673
GO:0032869 Biological process Cellular response to insulin stimulus IMP 17572128
Protein Information
 
Protein Name
CANP 10 , calpain-like protease CAPN10 , calcium-activated neutral proteinase 10 , OTTHUMP00000201424 , OTTHUMP00000164509 , KIAA1845 , Calcium-activated neutral proteinase 10 , OTTHUMP00000201396 , calpain 10, OTTHUMP00000201428 , calpain-10 , OTTHUMP00000201422 , NIDDM1 , CANP10 , OTTHUMP00000201427 , EC 3.4.22.-
 
Function
Calcium-regulated non-lysosomal thiol-protease which catalyze limited proteolysis of substrates involved in cytoskeletal remodeling and signal transduction
 
Refseq Proteins
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00648 Peptidase_C2 Calpain family cysteine protease
PF01067 Calpain_III Calpain large subunit, domain III
 
OMIM
 
Phenotype MIM ID
 
Interactions
STRING MINT I2D

Associated Diseases

Diseases References
Atherosclerosis 11756346, 20142250, 15793266, 19193380
Cardiovascular diseases 18698425, 17227582
Cataract 15362498
Diabetes gestational 15172858
Diabetes mellitus 16377260
   
References
 
Primary:

Association of CAPN10 SNPs and haplotypes with polycystic ovary syndrome among South Indian Women.

Dasgupta Shilpi, Sirisha Pisapati V S, Neelaveni Kudugunti, Anuradha Katragadda, Reddy B Mohan
Molecular Anthropology Group, Biological Anthropology Unit, Indian Statistical Institute, Hyderabad, Andhra Pradesh, India.
PLoS One. 2012;7(2):e32192. Epub 2012 Feb 23.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
PCOS 
UCSNP -43 
 
Related 
Chilean (50 PCOS, 70 controls ) 
The study suggests that UCSNP-43 gene polymorphism in CAPN10 gene contributes to PCOS 
 
PCOS 
UCSNP-63 
 
Direct 
PCOS patients 
CAPN 10 UCSNP-63 is associated with PCOS 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26376770
Association of Calpain (CAPN) 10 (UCSNP-43, rs3792267) gene polymorphism with elevated serum androgens in young women with the most severe phenotype of polycystic ovary syndrome (PCOS). 
Clinical study 
25982606
[Association analysis of SNP-63 and indel-19 variant in the calpain-10 gene with polycystic ovary syndrome in women of reproductive age]. 
Clinical study 
24993116
Common polymorphisms of calpain-10 and the risk of polycystic ovary syndrome in Tunisian population: a case-control study. 
Clinical study 
23994294
Calpain-10 genetic polymorphisms and polycystic ovary syndrome risk: a meta-analysis and meta-regression. 
Meta analysis 
23550965
The role of epistasis in the etiology of Polycystic Ovary Syndrome among Indian women: SNP-SNP and SNP-environment interactions. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412