AR

Gene Information
 
Gene Symbol
AR
 
Aliases
AIS8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM, AR
 
Entrez Gene ID
367
 
Gene Name
Androgen receptor
 
Chromosomal Location
Xq12
 
HGNC ID
644
 
Summary
The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract causes spinal bulbar muscular atrophy (Kennedy disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Two alternatively spliced variants encoding distinct isoforms have been described. (provided by RefSeq, Jul 2008)
 
GeneCards ID
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs6152 TAGAAGTTCTGATAGCAGAAAAAAGA
C/T
GCAGGATTTCCACAGAAGAGAAACT Synonymous codon 20450840

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006351 Biological process Transcription, DNA-templated IDA 15572661
GO:0006810 Biological process Transport TAS 10835690
GO:0007165 Biological process Signal transduction TAS 10835690
GO:0007267 Biological process Cell-cell signaling TAS 10835690
GO:0007548 Biological process Sex differentiation NAS 10075738
Protein Information
 
Protein Name
Androgen receptor
 
Function
Steroid hormone receptors are ligand-activated transcription factors that regulate eukaryotic gene expression and affect cellular proliferation and differentiation in target tissues. Transcription factor activity is modulated by bound coactivator and corepressor proteins. Transcription activation is down-regulated by NR0B2. Activated, but not phosphorylated, by HIPK3 and ZIPK/DAPK3
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00104 Hormone_recep Ligand-binding domain of nuclear hormone receptor
PF00105 zf-C4 Zinc finger, C4 type (two domains)
PF02166 Androgen_recep Androgen receptor
 
KEGG
 
OMIM

Associated Diseases

Diseases References
Androgen insensitivity syndrome 19178528, 9039340, 11549642, 11282274, 11684838, 11788673, 12006704, 12466388, 8325932, 9768671, 20333878, 18844449, 18978937, 17937062, 16619235, 15524101, 15519887, 15053245, 11238515, 18923000, 18697867, 18577874, 16544039, 16365032, 14992681, 10485299, 10385402, 10571951, 15705293, 15522944, 15171708, 12713250, 12682377, 10079022, 9890064, 9607727, 8809734, 9160185, 8823308, 18097502, 16544040, 15609126, 10458483, 11225909, 9533962, 9328206, 18319300, 14635106, 12213902, 11788616, 11587068, 9788719, 9519369, 9039995, 8126121, 19844078, 19330472, 19094205, 17970778, 16470553, 15919721, 1480178, 19931639, 17911242, 17408421, 10323251, 10221692, 7551823, 19004117, 1472458, 19482445, 18694860, 12638777, 11889162, 11260228, 10999818, 9642623, 9639978, 7489816, 19851057, 15486055, 18270433, 19276236, 18617596
Azoospermia 11549683, 12399527, 17919607, 2287116, 7926115, 20458976, 16400085, 17207798, 10999818, 12634316
Bone loss 18484228, 15827868, 18809737
Cancer (adenoma) 19061288, 12817426, 19391487, 10821498, 11668470, 19672785, 8625047, 17465263, 8568474
Cancer (carcinoma) 17017191, 12910513, 17020615, 17448017, 18429833, 8602398, 17543076, 16977795, 11438457, 7560348, 8883966, 11011957, 11494337, 10389621, 9924433, 9735408, 19622577, 16457154, 16045781, 14680496, 12817426, 11572759, 15525603, 19672785, 15663989, 14501770, 11556855, 16061644, 12352186, 11862478, 11668470, 19887463, 10761460, 19391487, 17922225, 17349546, 16682621, 10638964, 11351344, 9521507, 9076468, 10535570, 12713620, 15302512, 16075292
   
References
 
Primary:

Polymorphic CAG repeat in the androgen receptor gene in polycystic ovary syndrome patients.

Xia Yanjie, Che Yena, Zhang Xinlin, Zhang Chengwei, Cao Yunxia, Wang Wenjun, Xu Pei, Wu Xiaoke, Yi Long, Gao Qian, Wang Yong
Center for Translational Medicine and Jiangsu Key Laboratory of Molecular Medicine, Medical School of Nanjing University, Nanjing 210093, PR China.
Mol Med Report. 2012 May;5(5):1330-4. doi: 10.3892/mmr.2012.789. Epub 2012 Feb

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
26412465
Nonalcoholic fatty liver disease in children and adolescents - Relationship with Polycystic Ovary Syndrome. 
Clinical study 
26348137
Increased androgen levels in rats impair glucose-stimulated insulin secretion through disruption of pancreatic beta cell mitochondrial function. 
Animal study 
26322372
Hyperandrogenism and Insulin Resistance, Not Changes in Body Weight, Mediate the Development of Endothelial Dysfunction in a Female Rat Model of Polycystic Ovary Syndrome (PCOS). 
Animal study 
26206424
Effects of androgen on immunohistochemical localization of androgen receptor and Connexin 43 in mouse ovary. 
Animal study 
26199450
Follicular hyperandrogenism downregulates aromatase in luteinized granulosa cells in polycystic ovary syndrome women. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412