AMHR2

Gene Information
 
Gene Symbol
AMHR2
 
Aliases
AMHR, MISR2, MISRII, MRII
 
Entrez Gene ID
269
 
Gene Name
Anti-Mullerian hormone receptor, type II
 
Chromosomal Location
12q13
 
HGNC ID
465
 
Summary
This gene encodes the receptor for the anti-Mullerian hormone (AMH) which, in addition to testosterone, results in male sex differentiation. AMH and testosterone are produced in the testes by different cells and have different effects. Testosterone promotes the development of male genitalia while the binding of AMH to the encoded receptor prevents the development of the mullerian ducts into uterus and Fallopian tubes. Mutations in this gene are associated with persistent Mullerian duct syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. (provided by RefSeq, Sep 2009)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs2002555 TTGTGGGACTTCAGAAGAGAGAAAGA
C/T
GTGGGCTGGACATCAAAGAAGGCCT -482 A>G 23969185

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0001880 Biological process Mullerian duct regression NAS 14750901
GO:0007165 Biological process Signal transduction IMP 7493017
GO:0007548 Biological process Sex differentiation TAS 12834017
GO:0004872 Molecular function Receptor activity IMP 7493017
GO:0042562 Molecular function Hormone binding IPI 14750901
Protein Information
 
Protein Name
AMH type II receptor, MIS type II receptor, Muellerian inhibiting substance type II receptor, Mullerian inhibiting substance type II receptor, anti-Muellerian hormone type II receptor
 
Function
On ligand binding, forms a receptor complex consisting of two type II and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which autophosphorylate, then bind and activate SMAD transcriptional regulators. Receptor for anti-Muellerian hormone
 
Refseq Proteins
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF01064 Activin_recp
PF00069 Pkinase
PF12743 ESR1_C
PF00104 Hormone_recep
PF02159 Oest_recep
PF00105 zf-C4
 
KEGG
 
OMIM
 
Phenotype MIM ID

Associated Diseases

Diseases References
Polycystic ovary syndrome (PCOS) 23969185, 23321213
   
References
 
Primary:

Increased frequency of the anti-mullerian-inhibiting hormone receptor 2 (AMHR2) 482 A>G polymorphism in women with polycystic ovary syndrome: relationship to luteinizing hormone levels.

Georgopoulos Neoklis A, Karagiannidou Eleni, Koika Vasiliki, Roupas Nikolaos D, Armeni Anastasia, Marioli Dimitra, Papadakis Efstathios, Welt C K, Panidis Dimitrios
Department of Obstetrics and Gynecology, Division of Reproductive Endocrinology, University of Patras Medical School, University Hospital, 26500 Patras, Greece. neoklisg@hol.gr.
J Clin Endocrinol Metab. 2013 Nov;98(11):E1866-70. doi: 10.1210/jc.2013-2458.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
LH, FSH, Prolactin 
PCOS 
482 A>G polymorphism (rs2002555)  
Rotterdam criteria 
Related 
858 Caucasian Greek women with PCOS and 309 healthy control women 
In this study, the role of the AMHR2 -482 A>G gene polymorphism in the pathogenesis of PCOS was suggested by the association of the variant with PCOS risk.  
LH 
PCOS 
 
Rotterdam criteria 
Related 
30 women as controls and 21 normo-ovulatory and 19 oligo/anovulatory patients as PCOS group 
The overexpression of AMH and AMHR-II in oligo/anovulatory PCOS women could be due to increased LH levels and/or inhibition of its repressive action. The fact that this dysregulation is observed in oligo/anovulatory, but not in normo-ovulatory, PCOS women emphasizes the role of LH in the follicular arrest of PCOS women and suggests that this involves the AMH/AMHR-II system. 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412