AMH

Gene Information
 
Gene Symbol
AMH
 
Aliases
MIF, MIS
 
Entrez Gene ID
268
 
Gene Name
Anti-Mullerian hormone
 
Chromosomal Location
19p13.3
 
HGNC ID
464
 
Summary
Anti-Mullerian hormone is a member of the transforming growth factor-beta gene family which mediates male sexual differentiation. Anti-Mullerian hormone causes the regression of Mullerian ducts which would otherwise differentiate into the uterus and fallopian tubes. Some mutations in the anti-Mullerian hormone result in persistent Mullerian duct syndrome. (provided by RefSeq)
 
GeneCards ID
 
UniGene
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs10407022 AGAAGACTTGGACTGGCCTCCAGGCA
G/T
CCCACAAGAGCCTCTGTGCCTGGTG I49S 23371438, 18230658
rs8112524 AGAAGACTTGGACTGGCCTCCAGGCA
G/T
CCCACAAGAGCCTCTGTGCCTGGTG Intron variant,upstream variant 2KB 23371438

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0001880 Biological process Mullerian duct regression NAS 14750901
GO:0007267 Biological process Cell-cell signaling TAS 3754790
GO:0007530 Biological process Sex determination TAS 3754790
GO:0007548 Biological process Sex differentiation TAS 12834017
GO:0010628 Biological process Positive regulation of gene expression IMP 14695376
Protein Information
 
Protein Name
Anti-Mullerian hormone
 
Function
This glycoprotein, produced by the Sertoli cells of the testis, causes regression of the Muellerian duct. It is also able to inhibit the growth of tumors derived from tissues of Muellerian duct origin
 
UniProt
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00019 TGF_beta Transforming growth factor beta like domain
PF04709 AMH_N Anti-Mullerian hormone, N terminal region
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions
STRING MINT I2D
ENSP00000221496

Associated Diseases

Diseases References
Azoospermia 10374110
Cancer (aplasia) 10523039
Cryptorchidism 8468660
Endometriosis 9130910
Hyperandrogenism 24002402, 23980726, 23928669, 23506275, 22886405, 22541936, 21926054, 20610596, 18697861
   
References
 
Primary:

[Anti-Mullerian hormone in the major phenotypes of polycystic ovary syndrome].

Parahuleva N, Pehlivanov B, Orbecova M, Uchikova E, Ivancheva H
Akush Ginekol (Sofiia). 2014;53(5):22-7.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
 
 
 
Rotterdam criteria 
Related 
46 women with PCOS and 25 age-matched ovulatory controls 
Women with PCOS with the highest levels of MIS had higher ovarian volumes and values of LH, T, A, and insulin 
 
 
 
 
Related 
29 (13 controls, 16 PCO ) 
AMH levels are higher in polycystic ovaries as compared to normal ovaries 
 
Hyperandrogenism and oligoanovulation 
 
 
Direct 
 
AMH level is increased in PCOS 
 
PCOS 
 
 
Direct 
100 women with PCOS,  
These data on serum AMH levels in four major phenotypes of PCOS allow its use as an additional diagnostic criterion for diagnosis 
 
PCOS 
 
Rotterdam criteria 
Direct 
438 women attending the fertility clinic 
Subfertile women with PCOS secrete significantly more AMH per antral follicle than women with PCOM only and control women. 

Unreviewed Literature:

Show/Hide all(141)
PubMed / PMC ID
Title Type of study
26416764
Causal mechanisms and balancing selection inferred from genetic associations with polycystic ovary syndrome. 
Clinical study 
26408006
Comparison of clinical and hormonal characteristics among four phenotypes of polycystic ovary syndrome based on the Rotterdam criteria. 
Clinical study 
26359323
Anti-M??llerian hormone testing: Evaluation of a novel method allowing more automation. 
In vitro 
26357853, PMC4565016
Optimal cutoff value of basal anti-mullerian hormone in iranian infertile women for prediction of ovarian hyper-stimulation syndrome and poor response to stimulation. 
Clinical study 
26291804
1-h Postprandial glucose level is related to the serum anti-M??llerian hormone level in women with polycystic ovary syndrome. 
Clinical study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412