AKT2

Gene Information
 
Gene Symbol
AKT2
 
Aliases
HIHGHH, PKBB, PKBBETA, PRKBB, RAC-BETA
 
Entrez Gene ID
208
 
Gene Name
V-akt murine thymoma viral oncogene homolog 2
 
Chromosomal Location
19q13.1-q13.2
 
HGNC ID
392
 
Summary
This gene is a putative oncogene encoding a protein belonging to a subfamily of serine/threonine kinases containing SH2-like (Src homology 2-like) domains. The gene was shown to be amplified and overexpressed in 2 of 8 ovarian carcinoma cell lines and 2 of 15 primary ovarian tumors. Overexpression contributes to the malignant phenotype of a subset of human ductal pancreatic cancers. The encoded protein is a general protein kinase capable of phophorylating several known proteins. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs3730051 GGTGGAGGGAAATTTCAGTGTCATCT
A/G
GTGCCCCTCTCCCTTGAGGCAGGCG Intron variant 18768676
rs8100018 aaaaaaaaaaaaaaaaaaaGCAGGGG
C/G
CGGGGACAGGGCAGGAGCCCATTCC Intron variant 18768676

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0006464 Biological process Protein modification process TAS 1409633
GO:0010748 Biological process Negative regulation of plasma membrane long-chain fatty acid transport IMP 16814735
GO:0010907 Biological process Positive regulation of glucose metabolic process IMP 16814735
GO:0016310 Biological process Phosphorylation EXP 15314020
GO:0032000 Biological process Positive regulation of fatty acid beta-oxidation IMP 16814735
Protein Information
 
Protein Name
RAC-beta serine/threonine-protein kinase
 
Function
General protein kinase capable of phosphorylating several known proteins
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00069 Pkinase Protein kinase domain
PF00169 PH PH domain
PF00433 Pkinase_C Protein kinase C terminal domain
 
KEGG
MAPK signaling pathway, ErbB signaling pathway, Chemokine signaling pathway, mTOR signaling pathway, Apoptosis, VEGF signaling pathway, Osteoclast differentiation, Focal adhesion, Tight junction, Toll-like receptor signaling pathway, Jak-STAT signaling pathway, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Neurotrophin signaling pathway, Cholinergic synapse, Insulin signaling pathway, Progesterone-mediated oocyte maturation, Adipocytokine signaling pathway, Carbohydrate digestion and absorption, Chagas disease (American trypanosomiasis), Toxoplasmosis, Tuberculosis, Hepatitis C, Measles, Influenza A, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Melanoma, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer
 
OMIM
 
Phenotype MIM ID
 
Interactions

Associated Diseases

Diseases References
Cancer (carcinoma) 16721043, 17047397, 14735903, 17351921
Diabetes mellitus 15010337
Polycystic ovary syndrome (PCOS) 18768676
   
References
 
Primary:

First evidence of genetic association between AKT2 and polycystic ovary syndrome.

Goodarzi Mark O, Jones Michelle R, Chen Yii-Der I, Azziz Ricardo
Division of Endocrinology, Diabetes and Metabolism, Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, California, USA.
Diabetes Care. 2008 Dec;31(12):2284-7. Epub 2008 Sep 3.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
GSK3B 
 
rs3730051, rs8100018, rs11671439, rs2304188 
NIH criteria 
Related 
287 white women with PCOS, 187 white controls 
These data suggest that polymorphisms in two components of the insulin signaling pathway, AKT2 and GSK3B, are associated withPCOS. 

Unreviewed Literature:

PubMed / PMC ID
Title Type of study
24973798
Cryptotanshinone reverses ovarian insulin resistance in mice through activation of insulin signaling and the regulation of glucose transporters and hormone synthesizing enzymes. 
Animal study 
24423322, PMC3942235
The inflammatory gene pathway is not a major contributor to polycystic ovary snydrome. 
Clinical study 
22384551
[Controlling effect of bushen huatan compound on the insulin signal conducting molecule inside ovaries in polycystic ovary syndrome model rats]. 
Animal study 
22275470, PMC3339834
Loss of PKB??/Akt2 predisposes mice to ovarian cyst formation and increases the severity of polycystic ovary formation in vivo. 
Animal study 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412