ACVR1

Gene Information
 
Gene Symbol
ACVR1
 
Aliases
ACTRIA, ACVRLK2, ALK2, FOP, SKR1, TSRI, ACVR1
 
Entrez Gene ID
90
 
Gene Name
Activin A receptor, type I
 
Chromosomal Location
2q23-q24
 
HGNC ID
171
 
Summary
Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. (provided by RefSeq)
 
GeneCards ID
 
UniGene
 
RefSeq DNA
 
RefSeq mRNA
  e!Ensembl
Gene
Transcript  
Protein

SNPs

SNP Id
Upstream Sequence
SNP
Downstream Sequence Functional Significance References
rs1220134 CTTGAGGATCATATTACTCCAAGAGA
A/T
CTATCTGGTCATCAATTTTTATAAT Intron variant 18854405
rs10497189 CCACAATATGCATCAAAATGTGTTCT
C/T
GGACATTAGTTATTCTTAATAAAGA Intron variant 18854405
rs2033962 GTGCCATAGACCTTTGGAGGGAGCTC
G/T
GAAAGCTGAATTTCCTAATATGAAC Intron variant 18854405

Gene Ontology (GO)

GO ID Ontology Definition Evidence Reference
GO:0000082 Biological process G1/S transition of mitotic cell cycle IMP 9884026
GO:0006468 Biological process Protein phosphorylation IDA 12065756
GO:0007179 Biological process Transforming growth factor beta receptor signaling pathway IDA 8242742
GO:0009968 Biological process Negative regulation of signal transduction IMP 9884026
GO:0030278 Biological process Regulation of ossification IMP 16642017
Protein Information
 
Protein Name
Activin receptor type-1
 
Function
On ligand binding, forms a receptor complex consisting of two type II and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which autophosphorylate, then bind and activate SMAD transcriptional regulators. Receptor for activin. May be involved for left-right pattern formation during embryogenesis (By similarity)
 
Refseq Proteins
 
UniProt
 
PDB
 
InterPro
 
Pfam
Pfam Accession Pfam ID
PF00069 Pkinase Protein kinase domain
PF01064 Activin_recp Activin types I and II receptor domain
PF08515 TGF_beta_GS Transforming growth factor beta type I GS-motif
 
KEGG
 
OMIM
 
Phenotype MIM ID
 
Interactions

Associated Diseases

Diseases References
Cancer 9714055, 9850059
Fibrodysplasia ossificans progressiva 18019378, 18245597, 18684712, 19400542
Inflammation 12151307
Ossification heterotopic 19085907, 17967130
Polycystic ovary syndrome (PCOS) 20178540, 18854405
   
References
 
Primary:

Variants in the ACVR1 gene are associated with AMH levels in women with polycystic ovary syndrome.

Kevenaar Marlies E, Themmen Axel P N, van Kerkwijk Anke J, Valkenburg Olivier, Uitterlinden Andre G, de Jong Frank H, Laven Joop S E, Visser Jenny A
Department of Internal Medicine, Erasmus MC, PO Box 2040, 3000 CA Rotterdam, The Netherlands.
Hum Reprod. 2009 Jan;24(1):241-9. Epub 2008 Oct 14.
 
Supporting Literature:
PubMed ID Associated gene/s Associated condition Genetic Mutation Diagnostic Criteria Association with PCOS Ethnicity Conclusion
AMH 
 
variation in gene 
Rotterdam criteria 
Related 
359 PCOS patients and 30 normo-ovulatory and 3543 population-based control women 
Genetic variation within ACVR1 is associated with AMH levels and follicle number in PCOS women, suggesting that ALK2 signalling contributes to the disturbed folliculogenesis in PCOS patients. 
 
 
 
 
Related 
PCOS WOMENS (n = 14) and normal controls (n = 21) 
This is the first report to demonstrate the aberrantly increased expression of betaglycan mRNA in PCOS ovaries. The mechanism by which betaglycan contributes to the pathologic process of PCOS remains to be clarified. 

 

| © 2015, Biomedical Informatics Centre, NIRRH |
National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai-400 012
Tel: 91-22-24192104, Fax No: 91-22-24139412